Incidental Mutation 'R7770:Setd1b'
ID598522
Institutional Source Beutler Lab
Gene Symbol Setd1b
Ensembl Gene ENSMUSG00000038384
Gene NameSET domain containing 1B
SynonymsKMT2G
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7770 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123142193-123168629 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 123158752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056053] [ENSMUST00000162839] [ENSMUST00000163030] [ENSMUST00000174836]
Predicted Effect unknown
Transcript: ENSMUST00000056053
AA Change: E1259K
SMART Domains Protein: ENSMUSP00000134686
Gene: ENSMUSG00000038384
AA Change: E1259K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162839
SMART Domains Protein: ENSMUSP00000134353
Gene: ENSMUSG00000038384

DomainStartEndE-ValueType
SET 1 86 7.26e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163030
AA Change: E1259K
SMART Domains Protein: ENSMUSP00000133933
Gene: ENSMUSG00000038384
AA Change: E1259K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173221
Predicted Effect unknown
Transcript: ENSMUST00000174836
AA Change: E1218K
SMART Domains Protein: ENSMUSP00000134461
Gene: ENSMUSG00000038384
AA Change: E1218K

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.92e-7 PROSPERO
internal_repeat_1 279 296 1.92e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
coiled coil region 1149 1172 N/A INTRINSIC
low complexity region 1208 1221 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
low complexity region 1281 1342 N/A INTRINSIC
low complexity region 1361 1401 N/A INTRINSIC
low complexity region 1443 1507 N/A INTRINSIC
low complexity region 1559 1577 N/A INTRINSIC
N-SET 1651 1795 1.54e-67 SMART
SET 1805 1928 4.03e-36 SMART
PostSET 1928 1944 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Homozygous mutant animals died during organogenesis by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnah7c A T 1: 46,626,300 probably null Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Prmt9 T A 8: 77,559,185 probably null Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Slc22a19 T A 19: 7,703,995 probably null Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tgfbi T A 13: 56,632,844 probably null Het
Tmprss9 A G 10: 80,898,069 probably null Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Setd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Setd1b APN 5 123158747 unclassified probably benign
IGL01453:Setd1b APN 5 123158464 intron probably benign
IGL01637:Setd1b APN 5 123148513 missense unknown
IGL01792:Setd1b APN 5 123157146 missense unknown
IGL01877:Setd1b APN 5 123148448 missense unknown
IGL01906:Setd1b APN 5 123157667 missense unknown
IGL01942:Setd1b APN 5 123163426 missense possibly damaging 0.73
IGL02284:Setd1b APN 5 123163428 missense possibly damaging 0.52
IGL02667:Setd1b APN 5 123157497 missense unknown
IGL02850:Setd1b APN 5 123148589 missense unknown
IGL02864:Setd1b APN 5 123158939 unclassified probably benign
IGL03006:Setd1b APN 5 123148451 missense unknown
IGL03307:Setd1b APN 5 123148671 missense unknown
P0037:Setd1b UTSW 5 123165921 unclassified probably benign
R0282:Setd1b UTSW 5 123161017 unclassified probably benign
R0375:Setd1b UTSW 5 123157437 missense unknown
R0550:Setd1b UTSW 5 123157660 missense unknown
R0607:Setd1b UTSW 5 123159951 unclassified probably benign
R0844:Setd1b UTSW 5 123160685 unclassified probably benign
R0973:Setd1b UTSW 5 123160703 small insertion probably benign
R1119:Setd1b UTSW 5 123147716 missense unknown
R1266:Setd1b UTSW 5 123147841 missense unknown
R1370:Setd1b UTSW 5 123160685 unclassified probably benign
R1416:Setd1b UTSW 5 123160685 unclassified probably benign
R1575:Setd1b UTSW 5 123163147 splice site probably benign
R1862:Setd1b UTSW 5 123147613 missense unknown
R1987:Setd1b UTSW 5 123147706 missense unknown
R4109:Setd1b UTSW 5 123152074 small deletion probably benign
R4399:Setd1b UTSW 5 123161798 unclassified probably benign
R4445:Setd1b UTSW 5 123148104 missense unknown
R4577:Setd1b UTSW 5 123148616 missense unknown
R4604:Setd1b UTSW 5 123152074 small deletion probably benign
R4647:Setd1b UTSW 5 123148112 missense unknown
R4648:Setd1b UTSW 5 123148112 missense unknown
R4675:Setd1b UTSW 5 123160998 unclassified probably benign
R5044:Setd1b UTSW 5 123151866 missense unknown
R5071:Setd1b UTSW 5 123160914 unclassified probably benign
R5220:Setd1b UTSW 5 123143408 missense unknown
R5933:Setd1b UTSW 5 123158752 unclassified probably benign
R6247:Setd1b UTSW 5 123158398 intron probably benign
R6446:Setd1b UTSW 5 123161799 unclassified probably benign
R6714:Setd1b UTSW 5 123157591 missense unknown
R6907:Setd1b UTSW 5 123163232 unclassified probably benign
R7328:Setd1b UTSW 5 123152379 missense unknown
R7412:Setd1b UTSW 5 123152576 missense unknown
R7486:Setd1b UTSW 5 123163592 missense probably benign 0.03
R7542:Setd1b UTSW 5 123148447 missense unknown
R7555:Setd1b UTSW 5 123157757 missense unknown
R7611:Setd1b UTSW 5 123152594 missense unknown
R7764:Setd1b UTSW 5 123146559 missense unknown
R7881:Setd1b UTSW 5 123152273 missense unknown
R7964:Setd1b UTSW 5 123152273 missense unknown
R8131:Setd1b UTSW 5 123143380 missense unknown
Z1177:Setd1b UTSW 5 123158625 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCGAGTCCGAGTCTTCATC -3'
(R):5'- ACCATGTTCAGGCGGTGATG -3'

Sequencing Primer
(F):5'- AGATGACCGTACCTGGGGTG -3'
(R):5'- CGGTGATGGGAGTTGAGCCTC -3'
Posted On2019-11-26