Incidental Mutation 'R7770:Dennd5b'
ID 598529
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 045826-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R7770 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148943214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 554 (Y554C)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: Y554C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: Y554C

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,165,894 (GRCm39) V160E probably damaging Het
Abhd8 C T 8: 71,910,894 (GRCm39) G305S probably benign Het
Adamts20 A G 15: 94,231,579 (GRCm39) V870A probably benign Het
Agl A G 3: 116,551,886 (GRCm39) probably null Het
Cav3 A T 6: 112,449,147 (GRCm39) D55V probably damaging Het
Ccser2 T A 14: 36,648,831 (GRCm39) D556V probably damaging Het
Cdc20b T C 13: 113,215,193 (GRCm39) Y254H probably benign Het
Commd8 A G 5: 72,317,223 (GRCm39) L182S probably damaging Het
Cyp1b1 G A 17: 80,020,728 (GRCm39) A338V probably damaging Het
Def8 C A 8: 124,186,798 (GRCm39) D459E unknown Het
Dnah7c A T 1: 46,665,460 (GRCm39) probably null Het
Dnajc5b T A 3: 19,633,181 (GRCm39) C135S probably benign Het
Dnpep G A 1: 75,293,890 (GRCm39) probably benign Het
Drc1 C T 5: 30,507,856 (GRCm39) Q293* probably null Het
Glmp A G 3: 88,233,077 (GRCm39) S72G probably benign Het
Gm5431 A T 11: 48,779,285 (GRCm39) S546T probably benign Het
Gnptab T A 10: 88,247,782 (GRCm39) C70S probably benign Het
Gpr83 G A 9: 14,778,170 (GRCm39) R180Q probably damaging Het
Gucy1a1 A T 3: 82,016,112 (GRCm39) L292Q possibly damaging Het
Gzmd T C 14: 56,368,720 (GRCm39) D58G probably damaging Het
Hoxa10 A G 6: 52,211,245 (GRCm39) S224P possibly damaging Het
Hoxa13 G A 6: 52,237,247 (GRCm39) probably benign Het
Igsf6 A G 7: 120,667,548 (GRCm39) V156A probably benign Het
Il6st A T 13: 112,639,338 (GRCm39) I649F probably damaging Het
Kcnh3 G A 15: 99,131,147 (GRCm39) V507M probably damaging Het
Lgr5 A G 10: 115,307,899 (GRCm39) I253T probably damaging Het
Met T A 6: 17,491,406 (GRCm39) V56D possibly damaging Het
Mettl22 A T 16: 8,303,764 (GRCm39) I277F possibly damaging Het
Nadsyn1 G A 7: 143,359,740 (GRCm39) R411W probably damaging Het
Nrros T G 16: 31,962,346 (GRCm39) E557A probably benign Het
Or10ak14 A T 4: 118,611,254 (GRCm39) H162Q probably benign Het
Or5w1 T C 2: 87,486,813 (GRCm39) I151V not run Het
Or8j3b C T 2: 86,205,604 (GRCm39) V51M possibly damaging Het
Pih1d2 G A 9: 50,533,101 (GRCm39) R243Q not run Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Ppp1r3a A G 6: 14,754,977 (GRCm39) V90A probably benign Het
Prmt9 T A 8: 78,285,814 (GRCm39) probably null Het
Rapgef4 T A 2: 72,028,739 (GRCm39) N385K possibly damaging Het
Rbm28 G A 6: 29,164,627 (GRCm39) probably benign Het
Rhobtb3 A T 13: 76,065,934 (GRCm39) S150T probably damaging Het
Serpinb6b T C 13: 33,161,512 (GRCm39) V195A probably benign Het
Sesn1 T A 10: 41,770,054 (GRCm39) I99N probably damaging Het
Setd1b G A 5: 123,296,815 (GRCm39) probably benign Het
Slc22a19 T A 19: 7,681,360 (GRCm39) probably null Het
Slc9a4 T C 1: 40,640,123 (GRCm39) I305T probably damaging Het
Smg6 T A 11: 74,884,687 (GRCm39) N3K unknown Het
Spta1 C A 1: 174,023,547 (GRCm39) Y651* probably null Het
Tatdn3 G A 1: 190,791,053 (GRCm39) P74S probably benign Het
Tet2 C T 3: 133,186,056 (GRCm39) R1127Q possibly damaging Het
Tgfbi T A 13: 56,780,657 (GRCm39) probably null Het
Tmprss9 A G 10: 80,733,903 (GRCm39) probably null Het
Tox4 T C 14: 52,517,299 (GRCm39) Y10H probably damaging Het
Trappc10 A T 10: 78,046,679 (GRCm39) S407T probably damaging Het
Vmn2r59 A G 7: 41,708,336 (GRCm39) C24R probably damaging Het
Wdr24 C A 17: 26,046,070 (GRCm39) A465D probably benign Het
Wfdc8 A G 2: 164,439,594 (GRCm39) S263P unknown Het
Zc3h15 T A 2: 83,488,476 (GRCm39) I138N possibly damaging Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1861:Dennd5b UTSW 6 148,969,760 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCATTTCTGATATATAGATGTCCG -3'
(R):5'- AGCTCTAACTGGCCTAAAGTC -3'

Sequencing Primer
(F):5'- AGCAGAGGGTCTTTCTCT -3'
(R):5'- GCCAAGTATCAGTTTTATGTG -3'
Posted On 2019-11-26