Incidental Mutation 'R7770:Abhd8'
ID598533
Institutional Source Beutler Lab
Gene Symbol Abhd8
Ensembl Gene ENSMUSG00000007950
Gene Nameabhydrolase domain containing 8
Synonyms0910001L24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7770 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71456705-71463655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71458250 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 305 (G305S)
Ref Sequence ENSEMBL: ENSMUSP00000008094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008094]
Predicted Effect probably benign
Transcript: ENSMUST00000008094
AA Change: G305S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000008094
Gene: ENSMUSG00000007950
AA Change: G305S

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Hydrolase_4 164 397 2e-17 PFAM
Pfam:Abhydrolase_1 168 289 1.2e-19 PFAM
Pfam:Abhydrolase_5 168 391 2.4e-20 PFAM
Pfam:Abhydrolase_6 170 403 1.4e-17 PFAM
low complexity region 411 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upstream of, and in a head-to-head orientation with the gene for the mitochondrial ribosomal protein L34. The predicted protein contains alpha/beta hydrolase fold and secretory lipase domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnah7c A T 1: 46,626,300 probably null Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Prmt9 T A 8: 77,559,185 probably null Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc22a19 T A 19: 7,703,995 probably null Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tgfbi T A 13: 56,632,844 probably null Het
Tmprss9 A G 10: 80,898,069 probably null Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Abhd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Abhd8 APN 8 71457319 missense probably damaging 1.00
IGL01780:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02350:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02357:Abhd8 APN 8 71461477 missense probably benign 0.00
PIT4142001:Abhd8 UTSW 8 71461855 missense probably damaging 1.00
R0135:Abhd8 UTSW 8 71458074 missense probably benign 0.20
R0142:Abhd8 UTSW 8 71461862 missense probably damaging 0.96
R1006:Abhd8 UTSW 8 71458441 missense probably benign 0.19
R1411:Abhd8 UTSW 8 71461730 missense probably damaging 1.00
R1676:Abhd8 UTSW 8 71461873 missense probably damaging 1.00
R1937:Abhd8 UTSW 8 71461862 missense possibly damaging 0.93
R1985:Abhd8 UTSW 8 71463513 unclassified probably benign
R3724:Abhd8 UTSW 8 71461492 missense probably benign 0.14
R5254:Abhd8 UTSW 8 71458398 nonsense probably null
R5770:Abhd8 UTSW 8 71457328 missense probably benign 0.07
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6474:Abhd8 UTSW 8 71461715 missense probably damaging 1.00
R6501:Abhd8 UTSW 8 71461521 nonsense probably null
R6769:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
R6771:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
R7406:Abhd8 UTSW 8 71461762 missense probably benign
Z1088:Abhd8 UTSW 8 71461801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATTTGTCGTGCATGCCG -3'
(R):5'- GATCATGATCAACGGTGGGG -3'

Sequencing Primer
(F):5'- CCAATACTGGCCACTCAT -3'
(R):5'- ATGCCCACATGTGTCCTG -3'
Posted On2019-11-26