Incidental Mutation 'R7770:1700017B05Rik'
ID598537
Institutional Source Beutler Lab
Gene Symbol 1700017B05Rik
Ensembl Gene ENSMUSG00000032300
Gene NameRIKEN cDNA 1700017B05 gene
SynonymsD9Ertd278e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R7770 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location57253117-57262612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57258611 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 160 (V160E)
Ref Sequence ENSEMBL: ENSMUSP00000034846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034846] [ENSMUST00000213199] [ENSMUST00000215298] [ENSMUST00000217657]
Predicted Effect probably damaging
Transcript: ENSMUST00000034846
AA Change: V160E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034846
Gene: ENSMUSG00000032300
AA Change: V160E

DomainStartEndE-ValueType
low complexity region 265 284 N/A INTRINSIC
low complexity region 293 299 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 649 675 N/A INTRINSIC
low complexity region 692 728 N/A INTRINSIC
low complexity region 785 799 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213199
AA Change: V160E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000215298
Predicted Effect probably benign
Transcript: ENSMUST00000217657
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in 1700017B05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:1700017B05Rik APN 9 57258246 missense probably damaging 1.00
IGL01287:1700017B05Rik APN 9 57257757 missense probably damaging 1.00
IGL01798:1700017B05Rik APN 9 57256638 missense probably benign 0.10
IGL01933:1700017B05Rik APN 9 57257367 missense possibly damaging 0.95
IGL02146:1700017B05Rik APN 9 57256740 missense possibly damaging 0.82
IGL02158:1700017B05Rik APN 9 57256619 unclassified probably null
IGL02277:1700017B05Rik APN 9 57258425 missense probably benign 0.05
IGL02707:1700017B05Rik APN 9 57258645 missense probably benign
IGL02887:1700017B05Rik APN 9 57258885 missense probably damaging 1.00
IGL02936:1700017B05Rik APN 9 57258404 missense possibly damaging 0.69
R0583:1700017B05Rik UTSW 9 57257643 missense probably benign 0.04
R0926:1700017B05Rik UTSW 9 57257549 missense probably damaging 0.99
R1812:1700017B05Rik UTSW 9 57257457 nonsense probably null
R1903:1700017B05Rik UTSW 9 57258352 missense possibly damaging 0.69
R4542:1700017B05Rik UTSW 9 57256592 missense probably damaging 1.00
R4596:1700017B05Rik UTSW 9 57257805 missense probably benign 0.03
R4631:1700017B05Rik UTSW 9 57257987 missense probably damaging 1.00
R4869:1700017B05Rik UTSW 9 57254205 missense probably damaging 1.00
R5265:1700017B05Rik UTSW 9 57258894 missense probably damaging 1.00
R5361:1700017B05Rik UTSW 9 57257185 missense probably damaging 1.00
R6216:1700017B05Rik UTSW 9 57257627 missense probably benign 0.33
R6356:1700017B05Rik UTSW 9 57254009 missense probably benign 0.11
R6579:1700017B05Rik UTSW 9 57254224 missense possibly damaging 0.89
R6774:1700017B05Rik UTSW 9 57256625 missense probably damaging 1.00
R6921:1700017B05Rik UTSW 9 57258736 missense probably damaging 1.00
R7089:1700017B05Rik UTSW 9 57258758 missense probably damaging 1.00
R7196:1700017B05Rik UTSW 9 57258222 frame shift probably null
R7197:1700017B05Rik UTSW 9 57258222 frame shift probably null
R7728:1700017B05Rik UTSW 9 57256539 missense probably damaging 1.00
R7812:1700017B05Rik UTSW 9 57257858 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGTGCTTTGGATAGTTCGATAC -3'
(R):5'- AAACTGCCTGCTCTACCGTC -3'

Sequencing Primer
(F):5'- GATACTTCTCCAAGAATGCCTGG -3'
(R):5'- AGGCTCTGAAAAGATACAAGACTC -3'
Posted On2019-11-26