Incidental Mutation 'R7770:Gm5431'
ID598542
Institutional Source Beutler Lab
Gene Symbol Gm5431
Ensembl Gene ENSMUSG00000058163
Gene Namepredicted gene 5431
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7770 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location48887422-48902214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48888458 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 546 (S546T)
Ref Sequence ENSEMBL: ENSMUSP00000104833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109209] [ENSMUST00000109210] [ENSMUST00000109212]
Predicted Effect probably benign
Transcript: ENSMUST00000109209
AA Change: S546T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104832
Gene: ENSMUSG00000058163
AA Change: S546T

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109210
AA Change: S546T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104833
Gene: ENSMUSG00000058163
AA Change: S546T

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109212
AA Change: S824T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104835
Gene: ENSMUSG00000058163
AA Change: S824T

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2.5e-125 PFAM
Pfam:DLIC 54 107 3.4e-5 PFAM
Pfam:MMR_HSR1 72 235 1.7e-11 PFAM
low complexity region 431 444 N/A INTRINSIC
Pfam:IIGP 447 820 6.3e-153 PFAM
Pfam:MMR_HSR1 483 606 2.4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tox4 T C 14: 52,279,842 Y10H probably damaging Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Gm5431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Gm5431 APN 11 48895414 missense probably benign 0.09
IGL00964:Gm5431 APN 11 48889267 missense probably damaging 0.99
IGL01571:Gm5431 APN 11 48894713 missense probably benign 0.00
IGL02006:Gm5431 APN 11 48888503 missense probably damaging 1.00
IGL02084:Gm5431 APN 11 48889085 missense probably benign 0.41
IGL02255:Gm5431 APN 11 48888958 missense possibly damaging 0.93
IGL02291:Gm5431 APN 11 48888964 missense probably damaging 1.00
IGL03194:Gm5431 APN 11 48895537 intron probably benign
IGL03251:Gm5431 APN 11 48894721 missense probably benign 0.00
R1168:Gm5431 UTSW 11 48895364 missense probably benign 0.36
R1387:Gm5431 UTSW 11 48895015 missense possibly damaging 0.92
R1396:Gm5431 UTSW 11 48895434 intron probably benign
R1711:Gm5431 UTSW 11 48895026 missense possibly damaging 0.73
R1750:Gm5431 UTSW 11 48894831 missense probably benign 0.01
R1927:Gm5431 UTSW 11 48889255 missense probably damaging 1.00
R1957:Gm5431 UTSW 11 48888397 nonsense probably null
R2196:Gm5431 UTSW 11 48889231 missense probably damaging 1.00
R2509:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R2511:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R4018:Gm5431 UTSW 11 48889168 missense probably damaging 1.00
R4859:Gm5431 UTSW 11 48889582 missense probably damaging 1.00
R4895:Gm5431 UTSW 11 48889028 missense probably damaging 0.98
R5124:Gm5431 UTSW 11 48889039 missense probably benign 0.31
R5311:Gm5431 UTSW 11 48888889 missense probably damaging 1.00
R5600:Gm5431 UTSW 11 48894756 missense possibly damaging 0.56
R5728:Gm5431 UTSW 11 48888613 missense probably damaging 1.00
R5731:Gm5431 UTSW 11 48894448 missense probably damaging 0.96
R6120:Gm5431 UTSW 11 48894781 missense probably benign 0.36
R6129:Gm5431 UTSW 11 48889591 missense probably damaging 1.00
R6169:Gm5431 UTSW 11 48888575 missense probably benign 0.29
R6192:Gm5431 UTSW 11 48894393 missense probably benign 0.01
R6253:Gm5431 UTSW 11 48894999 missense probably benign 0.00
R6326:Gm5431 UTSW 11 48889345 missense probably damaging 1.00
R6401:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R6654:Gm5431 UTSW 11 48894600 missense possibly damaging 0.91
R6810:Gm5431 UTSW 11 48888976 missense probably damaging 1.00
R6965:Gm5431 UTSW 11 48895200 missense probably benign 0.19
R6970:Gm5431 UTSW 11 48888490 missense probably damaging 1.00
R7269:Gm5431 UTSW 11 48888410 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCTACTTGCCACAGTGG -3'
(R):5'- ACACCTTAGGTCTCTCCAGTTG -3'

Sequencing Primer
(F):5'- CACAGTGGTATTCTCTCTCTGAAAG -3'
(R):5'- GGTCTCTCCAGTTGTTAACAAAG -3'
Posted On2019-11-26