Incidental Mutation 'R7770:Tox4'
ID598549
Institutional Source Beutler Lab
Gene Symbol Tox4
Ensembl Gene ENSMUSG00000016831
Gene NameTOX high mobility group box family member 4
Synonyms5730589K01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7770 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52279146-52296401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52279842 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 10 (Y10H)
Ref Sequence ENSEMBL: ENSMUSP00000022766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022765] [ENSMUST00000022766] [ENSMUST00000100631] [ENSMUST00000167116] [ENSMUST00000172488] [ENSMUST00000174020]
Predicted Effect probably benign
Transcript: ENSMUST00000022765
SMART Domains Protein: ENSMUSP00000022765
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
RAB 7 170 7.66e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022766
AA Change: Y10H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022766
Gene: ENSMUSG00000016831
AA Change: Y10H

DomainStartEndE-ValueType
low complexity region 146 160 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
HMG 222 292 1.17e-18 SMART
low complexity region 307 339 N/A INTRINSIC
low complexity region 435 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100631
SMART Domains Protein: ENSMUSP00000098197
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
RAB 7 168 6.88e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167116
SMART Domains Protein: ENSMUSP00000131145
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
RAB 7 170 7.66e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172488
SMART Domains Protein: ENSMUSP00000133787
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
Pfam:Miro 8 62 3.5e-7 PFAM
Pfam:Ras 8 62 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172634
Predicted Effect probably benign
Transcript: ENSMUST00000174020
SMART Domains Protein: ENSMUSP00000134726
Gene: ENSMUSG00000022159

DomainStartEndE-ValueType
small_GTPase 7 70 5.2e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,611 V160E probably damaging Het
Abhd8 C T 8: 71,458,250 G305S probably benign Het
Adamts20 A G 15: 94,333,698 V870A probably benign Het
Agl A G 3: 116,758,237 probably null Het
Cav3 A T 6: 112,472,186 D55V probably damaging Het
Ccser2 T A 14: 36,926,874 D556V probably damaging Het
Cdc20b T C 13: 113,078,659 Y254H probably benign Het
Commd8 A G 5: 72,159,880 L182S probably damaging Het
Cyp1b1 G A 17: 79,713,299 A338V probably damaging Het
Def8 C A 8: 123,460,059 D459E unknown Het
Dennd5b T C 6: 149,041,716 Y554C probably damaging Het
Dnah7c A T 1: 46,626,300 probably null Het
Dnajc5b T A 3: 19,579,017 C135S probably benign Het
Dnpep G A 1: 75,317,246 probably benign Het
Drc1 C T 5: 30,350,512 Q293* probably null Het
Glmp A G 3: 88,325,770 S72G probably benign Het
Gm5431 A T 11: 48,888,458 S546T probably benign Het
Gnptab T A 10: 88,411,920 C70S probably benign Het
Gpr83 G A 9: 14,866,874 R180Q probably damaging Het
Gucy1a1 A T 3: 82,108,805 L292Q possibly damaging Het
Gzmd T C 14: 56,131,263 D58G probably damaging Het
Hoxa10 A G 6: 52,234,265 S224P possibly damaging Het
Hoxa13 G A 6: 52,260,267 probably benign Het
Igsf6 A G 7: 121,068,325 V156A probably benign Het
Il6st A T 13: 112,502,804 I649F probably damaging Het
Kcnh3 G A 15: 99,233,266 V507M probably damaging Het
Lgr5 A G 10: 115,471,994 I253T probably damaging Het
Met T A 6: 17,491,407 V56D possibly damaging Het
Mettl22 A T 16: 8,485,900 I277F possibly damaging Het
Nadsyn1 G A 7: 143,806,003 R411W probably damaging Het
Nrros T G 16: 32,143,528 E557A probably benign Het
Olfr1057 C T 2: 86,375,260 V51M possibly damaging Het
Olfr1134 T C 2: 87,656,469 I151V not run Het
Olfr1338 A T 4: 118,754,057 H162Q probably benign Het
Pih1d2 G A 9: 50,621,801 R243Q not run Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppp1r3a A G 6: 14,754,978 V90A probably benign Het
Prmt9 T A 8: 77,559,185 probably null Het
Rapgef4 T A 2: 72,198,395 N385K possibly damaging Het
Rbm28 G A 6: 29,164,628 probably benign Het
Rhobtb3 A T 13: 75,917,815 S150T probably damaging Het
Serpinb6b T C 13: 32,977,529 V195A probably benign Het
Sesn1 T A 10: 41,894,058 I99N probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Slc22a19 T A 19: 7,703,995 probably null Het
Slc9a4 T C 1: 40,600,963 I305T probably damaging Het
Smg6 T A 11: 74,993,861 N3K unknown Het
Spta1 C A 1: 174,195,981 Y651* probably null Het
Tatdn3 G A 1: 191,058,856 P74S probably benign Het
Tet2 C T 3: 133,480,295 R1127Q possibly damaging Het
Tgfbi T A 13: 56,632,844 probably null Het
Tmprss9 A G 10: 80,898,069 probably null Het
Trappc10 A T 10: 78,210,845 S407T probably damaging Het
Vmn2r59 A G 7: 42,058,912 C24R probably damaging Het
Wdr24 C A 17: 25,827,096 A465D probably benign Het
Wfdc8 A G 2: 164,597,674 S263P unknown Het
Zc3h15 T A 2: 83,658,132 I138N possibly damaging Het
Other mutations in Tox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tox4 APN 14 52285745 missense probably damaging 1.00
Gift UTSW 14 52286756 missense probably damaging 1.00
PIT4494001:Tox4 UTSW 14 52291803 missense possibly damaging 0.71
R0517:Tox4 UTSW 14 52292628 missense probably benign 0.01
R0801:Tox4 UTSW 14 52279878 missense probably benign 0.28
R1640:Tox4 UTSW 14 52292543 missense possibly damaging 0.53
R2980:Tox4 UTSW 14 52292526 missense probably benign 0.00
R3899:Tox4 UTSW 14 52279842 missense probably damaging 0.98
R4016:Tox4 UTSW 14 52285904 critical splice donor site probably null
R4614:Tox4 UTSW 14 52287467 missense probably damaging 0.99
R5764:Tox4 UTSW 14 52285820 missense probably damaging 0.96
R5847:Tox4 UTSW 14 52286784 missense probably damaging 0.99
R6669:Tox4 UTSW 14 52286756 missense probably damaging 1.00
R6978:Tox4 UTSW 14 52287237 intron probably null
R7155:Tox4 UTSW 14 52292097 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCTTGAGGAAGTGACGC -3'
(R):5'- TTAGAGGAGCTCGAAGCCTC -3'

Sequencing Primer
(F):5'- AAGTGACGCGCTCGGAAC -3'
(R):5'- AAGCCTCGGCCACTGTC -3'
Posted On2019-11-26