Incidental Mutation 'R7771:Olfr339'
ID598559
Institutional Source Beutler Lab
Gene Symbol Olfr339
Ensembl Gene ENSMUSG00000094464
Gene Nameolfactory receptor 339
SynonymsMOR136-3, GA_x6K02T2NLDC-33116096-33117025
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36418947-36426123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36422144 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000149068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071437] [ENSMUST00000216645]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071437
AA Change: S249P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071383
Gene: ENSMUSG00000094464
AA Change: S249P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-55 PFAM
Pfam:7tm_1 41 290 5e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216645
AA Change: S249P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Olfr339
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr339 APN 2 36421704 missense probably benign 0.44
IGL01447:Olfr339 APN 2 36421454 missense probably damaging 0.97
IGL01845:Olfr339 APN 2 36422093 missense probably benign 0.27
IGL02728:Olfr339 APN 2 36422144 missense possibly damaging 0.95
IGL02941:Olfr339 APN 2 36422120 missense probably damaging 1.00
R0128:Olfr339 UTSW 2 36422287 missense probably benign 0.16
R0130:Olfr339 UTSW 2 36422287 missense probably benign 0.16
R1432:Olfr339 UTSW 2 36421643 missense probably damaging 1.00
R1451:Olfr339 UTSW 2 36421865 missense probably benign 0.01
R1656:Olfr339 UTSW 2 36421646 missense probably benign 0.00
R1854:Olfr339 UTSW 2 36421874 missense probably damaging 0.97
R2012:Olfr339 UTSW 2 36421919 missense probably benign 0.00
R2093:Olfr339 UTSW 2 36421929 missense probably benign 0.00
R2136:Olfr339 UTSW 2 36421938 missense probably damaging 1.00
R2282:Olfr339 UTSW 2 36422000 missense probably benign 0.00
R4363:Olfr339 UTSW 2 36421532 missense probably damaging 1.00
R4466:Olfr339 UTSW 2 36422296 missense probably benign 0.00
R4628:Olfr339 UTSW 2 36421857 nonsense probably null
R4839:Olfr339 UTSW 2 36422000 missense probably benign 0.00
R6023:Olfr339 UTSW 2 36421511 missense probably damaging 0.98
R6305:Olfr339 UTSW 2 36421622 missense probably damaging 1.00
R6486:Olfr339 UTSW 2 36421544 missense probably damaging 1.00
R6851:Olfr339 UTSW 2 36421820 missense probably damaging 0.97
R6864:Olfr339 UTSW 2 36421820 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACCATCAATGAGCTGGTCATC -3'
(R):5'- TTGTACCAATCAAGGAGGAGAC -3'

Sequencing Primer
(F):5'- CAATGAGCTGGTCATCTTTGTTTTAG -3'
(R):5'- CATAAGGTGCATCATTTTGTTCTGC -3'
Posted On2019-11-26