Incidental Mutation 'R7771:Trpm2'
ID598583
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77932179 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 829 (I829V)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: I829V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: I829V

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Meta Mutation Damage Score 0.0944 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R7927:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCGGAATCTGAGGTCAATC -3'
(R):5'- TCTTCTGCAGGGAAAAGAGGC -3'

Sequencing Primer
(F):5'- CCGGAATCTGAGGTCAATCATGTG -3'
(R):5'- AAAGAGGCTGCAGGCAC -3'
Posted On2019-11-26