Incidental Mutation 'R7771:Pitpnm3'
ID598584
Institutional Source Beutler Lab
Gene Symbol Pitpnm3
Ensembl Gene ENSMUSG00000040543
Gene NamePITPNM family member 3
SynonymsAckr6, A330068P14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7771 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72047528-72135778 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 72061488 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 626 (Q626*)
Ref Sequence ENSEMBL: ENSMUSP00000074737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]
Predicted Effect probably null
Transcript: ENSMUST00000075258
AA Change: Q626*
SMART Domains Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: Q626*

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Blast:DDHD 141 361 1e-105 BLAST
DDHD 390 594 1.49e-91 SMART
LNS2 739 870 2.12e-55 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108508
AA Change: Q610*
SMART Domains Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: Q610*

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Blast:DDHD 125 345 1e-106 BLAST
DDHD 374 578 1.49e-91 SMART
LNS2 723 854 2.12e-55 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Pitpnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Pitpnm3 APN 11 72112251 splice site probably benign
IGL01871:Pitpnm3 APN 11 72056138 missense probably damaging 0.99
IGL02058:Pitpnm3 APN 11 72120139 missense probably benign 0.31
IGL02267:Pitpnm3 APN 11 72071448 missense probably benign 0.02
IGL02370:Pitpnm3 APN 11 72051858 missense probably benign 0.04
IGL02613:Pitpnm3 APN 11 72058072 missense probably damaging 1.00
IGL02835:Pitpnm3 APN 11 72061466 splice site probably benign
IGL02946:Pitpnm3 APN 11 72092552 missense probably benign 0.08
IGL02989:Pitpnm3 APN 11 72120186 splice site probably benign
IGL03173:Pitpnm3 APN 11 72092563 missense probably benign 0.02
IGL03357:Pitpnm3 APN 11 72070890 nonsense probably null
Frank UTSW 11 72070396 missense probably benign
Mickey UTSW 11 72070964 missense probably damaging 1.00
Stuart UTSW 11 72051929 missense probably null 0.99
R0102:Pitpnm3 UTSW 11 72056246 missense probably damaging 1.00
R0193:Pitpnm3 UTSW 11 72070492 splice site probably benign
R0964:Pitpnm3 UTSW 11 72058470 missense probably damaging 1.00
R1475:Pitpnm3 UTSW 11 72074627 missense probably damaging 1.00
R1566:Pitpnm3 UTSW 11 72058959 splice site probably null
R1951:Pitpnm3 UTSW 11 72074624 missense possibly damaging 0.88
R3915:Pitpnm3 UTSW 11 72112284 missense probably damaging 1.00
R4192:Pitpnm3 UTSW 11 72051959 missense possibly damaging 0.96
R4278:Pitpnm3 UTSW 11 72074516 missense probably damaging 1.00
R4928:Pitpnm3 UTSW 11 72063172 missense probably damaging 1.00
R5543:Pitpnm3 UTSW 11 72056197 missense probably damaging 0.99
R5626:Pitpnm3 UTSW 11 72112332 missense probably benign 0.04
R5635:Pitpnm3 UTSW 11 72067160 missense possibly damaging 0.95
R5958:Pitpnm3 UTSW 11 72112367 splice site probably null
R6531:Pitpnm3 UTSW 11 72071487 missense possibly damaging 0.94
R6634:Pitpnm3 UTSW 11 72051929 missense probably null 0.99
R6764:Pitpnm3 UTSW 11 72051233 missense probably damaging 1.00
R6912:Pitpnm3 UTSW 11 72070396 missense probably benign
R7132:Pitpnm3 UTSW 11 72051276 missense possibly damaging 0.86
R7307:Pitpnm3 UTSW 11 72070964 missense probably damaging 1.00
R7561:Pitpnm3 UTSW 11 72051182 missense probably benign 0.02
X0018:Pitpnm3 UTSW 11 72071440 missense probably benign 0.42
X0062:Pitpnm3 UTSW 11 72067108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAGCCATCATTCCACAACTG -3'
(R):5'- GAAGCTGGCAACTGTTTGGG -3'

Sequencing Primer
(F):5'- ACTTTTACCATCCCGGGAGC -3'
(R):5'- CAACTGTTTGGGGAGGCAG -3'
Posted On2019-11-26