Incidental Mutation 'R7771:Ttc37'
ID598593
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Nametetratricopeptide repeat domain 37
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R7771 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location76098734-76190316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76135030 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 792 (H792R)
Ref Sequence ENSEMBL: ENSMUSP00000089045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
Predicted Effect probably benign
Transcript: ENSMUST00000091466
AA Change: H792R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: H792R

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224386
AA Change: H792R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000225220
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
caviar UTSW 13 76147767 missense possibly damaging 0.54
gourmet UTSW 13 76150519 missense probably damaging 1.00
tartare UTSW 13 76185179 missense probably damaging 0.96
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 unclassified probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5208:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5302:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5306:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5726:Ttc37 UTSW 13 76118347 missense probably damaging 1.00
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R5899:Ttc37 UTSW 13 76111819 splice site probably null
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
R7261:Ttc37 UTSW 13 76113579 missense probably benign 0.30
R7267:Ttc37 UTSW 13 76180077 missense probably benign 0.15
R7348:Ttc37 UTSW 13 76182884 missense possibly damaging 0.82
R7384:Ttc37 UTSW 13 76150735 missense possibly damaging 0.53
R7404:Ttc37 UTSW 13 76148747 nonsense probably null
R7421:Ttc37 UTSW 13 76148825 missense probably benign 0.12
R7546:Ttc37 UTSW 13 76134835 missense probably damaging 1.00
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCTGAGTCTTGGAGGAAGG -3'
(R):5'- GGTTATTACTGTCCAGCCTCAC -3'

Sequencing Primer
(F):5'- GGTGACTTACAGAGATTACCAGTC -3'
(R):5'- CACTGCCTTTTTCAGACACTAAAAAG -3'
Posted On2019-11-26