Incidental Mutation 'R7771:Gzma'
ID598594
Institutional Source Beutler Lab
Gene Symbol Gzma
Ensembl Gene ENSMUSG00000023132
Gene Namegranzyme A
SynonymsTSP1, Ctla3, H factor, Ctla-3, SE1, serine esterase 1, BLT esterase, TSP-1, Hanukah factor, Hf
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7771 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location113093825-113100981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113098295 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 54 (C54Y)
Ref Sequence ENSEMBL: ENSMUSP00000023897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023897] [ENSMUST00000224282]
Predicted Effect probably damaging
Transcript: ENSMUST00000023897
AA Change: C54Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023897
Gene: ENSMUSG00000023132
AA Change: C54Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 252 1.1e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224282
AA Change: C51Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show normal T/NK cell-mediated cytotoxicity, recovery from LCM virus or L. monocytogenes infection, and control of syngeneic tumor growth. Homozygotes for a different null allele show defective CTL cytolysis and increased tumor burden upon challenge with RMAS cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Gzma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gzma APN 13 113093884 utr 3 prime probably benign
R0965:Gzma UTSW 13 113098334 missense probably damaging 1.00
R1411:Gzma UTSW 13 113096208 missense probably benign 0.13
R1597:Gzma UTSW 13 113095797 missense probably damaging 1.00
R1838:Gzma UTSW 13 113095984 missense probably damaging 0.99
R1950:Gzma UTSW 13 113093929 missense probably damaging 1.00
R4153:Gzma UTSW 13 113096268 missense possibly damaging 0.92
R4389:Gzma UTSW 13 113098388 splice site probably null
R5370:Gzma UTSW 13 113095795 missense probably damaging 1.00
R5643:Gzma UTSW 13 113098260 missense probably damaging 1.00
R5644:Gzma UTSW 13 113098260 missense probably damaging 1.00
R7798:Gzma UTSW 13 113096324 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTTGTGACAAATCTGGGCTTAAC -3'
(R):5'- ATGCCTTGTTCCAGAAATGTGG -3'

Sequencing Primer
(F):5'- AGGCAGGTTGTCAAAGACTTCCC -3'
(R):5'- CCAGAAATGTGGCTTTCTTGAG -3'
Posted On2019-11-26