Mutagenetix > Incidental Mutation

Incidental Mutation 'R7771:Zswim8'

598595

Institutional Source

Beutler Lab

Gene Symbol

Zswim8

Ensembl Gene

ENSMUSG00000021819

Gene Name

zinc finger SWIM-type containing 8

Synonyms

2310021P13Rik, 4832404P21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R7771 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20707552-20723619 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20712980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 316 (V316I)

Ref Sequence

ENSEMBL: ENSMUSP00000022358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]

AlphaFold

Q3UHH1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022358
AA Change: V316I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: V316I

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC
low complexity region	89	102	N/A	INTRINSIC
low complexity region	390	405	N/A	INTRINSIC
low complexity region	578	612	N/A	INTRINSIC
low complexity region	736	751	N/A	INTRINSIC
low complexity region	1000	1015	N/A	INTRINSIC
low complexity region	1120	1135	N/A	INTRINSIC
low complexity region	1176	1211	N/A	INTRINSIC
low complexity region	1259	1270	N/A	INTRINSIC
low complexity region	1343	1355	N/A	INTRINSIC
low complexity region	1470	1487	N/A	INTRINSIC
low complexity region	1491	1511	N/A	INTRINSIC
low complexity region	1527	1542	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223840
AA Change: V316I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000224129

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224751
AA Change: V316I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (56/56)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,239,191	A1287T	probably damaging	Het
Ahnak	A	G	19: 9,015,047	K4565R	probably damaging	Het
Asb13	A	G	13: 3,649,463	Y221C	probably damaging	Het
BB014433	C	T	8: 15,042,395	V153M	probably damaging	Het
Brip1	T	C	11: 86,062,024	E977G	probably benign	Het
C3	T	A	17: 57,215,797	D1029V	probably damaging	Het
Ccdc116	T	C	16: 17,139,591	E568G	probably benign	Het
Cdhr2	T	C	13: 54,718,275	V296A	probably damaging	Het
Cenpe	A	G	3: 135,240,941		probably null	Het
Cnot1	A	G	8: 95,765,125	V357A	probably damaging	Het
Coa3	A	T	11: 101,278,815	M38K	possibly damaging	Het
Cyp2d26	T	C	15: 82,791,746	N255S	probably benign	Het
Cysrt1	T	C	2: 25,239,225	S92G	probably benign	Het
D030056L22Rik	A	G	19: 18,713,478	E52G	possibly damaging	Het
Derl1	T	C	15: 57,880,040	D97G	probably damaging	Het
Ebf3	A	G	7: 137,309,363	Y141H	probably damaging	Het
Eci1	T	A	17: 24,433,151	L49*	probably null	Het
Fam208a	A	G	14: 27,467,559	T923A	probably damaging	Het
Gm7534	A	T	4: 134,195,443	N526K	probably benign	Het
Gzma	C	T	13: 113,098,295	C54Y	probably damaging	Het
Hydin	A	G	8: 110,565,085	N3403S	probably damaging	Het
Ide	T	C	19: 37,298,126	N495D		Het
Ighv1-23	T	A	12: 114,764,736	Q22L	probably benign	Het
Itgb2l	A	G	16: 96,426,972	C444R	probably damaging	Het
Kcnj3	C	A	2: 55,446,937	H272N	probably damaging	Het
Lrp6	C	T	6: 134,462,616	C1218Y	probably damaging	Het
Lrrd1	T	C	5: 3,866,476	M831T	possibly damaging	Het
Map3k11	A	G	19: 5,690,608	E121G	probably damaging	Het
Mzt1	A	T	14: 99,040,576	I52N	probably damaging	Het
Olfr339	T	C	2: 36,422,144	S249P	possibly damaging	Het
Olfr617	A	G	7: 103,584,090	I23V	probably benign	Het
Olfr857	T	A	9: 19,713,471	F215I	probably benign	Het
Pcdhb17	A	C	18: 37,486,909	Y584S	possibly damaging	Het
Per3	A	T	4: 151,026,200	D380E	probably damaging	Het
Per3	A	T	4: 151,041,445	L139Q	probably damaging	Het
Pik3cg	T	C	12: 32,204,014	H658R	probably benign	Het
Pitpnm3	G	A	11: 72,061,488	Q626*	probably null	Het
Polr3e	T	C	7: 120,940,578	V542A	probably benign	Het
Rgs22	T	A	15: 36,050,078	H866L	possibly damaging	Het
Rnf150	A	G	8: 82,864,203	E65G	probably benign	Het
Sema3f	C	A	9: 107,692,426	R100L	possibly damaging	Het
Smim18	T	C	8: 33,742,342	D83G	possibly damaging	Het
Snx13	T	A	12: 35,124,528	D685E	probably benign	Het
Stat5a	A	C	11: 100,863,219	N125T	probably benign	Het
Stk24	T	C	14: 121,337,633	E21G	probably damaging	Het
Tlr3	C	T	8: 45,403,039	V35I	probably benign	Het
Tmem8	T	C	17: 26,122,073	Y717H	probably damaging	Het
Tmprss11b	A	T	5: 86,661,695		probably null	Het
Trpm2	T	C	10: 77,932,179	I829V	probably benign	Het
Ttc37	A	G	13: 76,135,030	H792R	probably benign	Het
Ttc39a	T	C	4: 109,431,450	Y276H	probably damaging	Het
Vmn2r98	T	A	17: 19,067,198		probably null	Het
Wdr73	G	A	7: 80,893,227	A211V	probably benign	Het
Zc3h4	T	C	7: 16,429,899	V673A	unknown	Het
Zfp382	A	G	7: 30,133,335	H137R	probably damaging	Het
Zp2	T	G	7: 120,143,642	D89A	probably damaging	Het
Zranb3	A	C	1: 128,032,868	Y220D	probably damaging	Het

Other mutations in Zswim8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Zswim8	APN	14	20718475	missense	probably damaging	0.99
IGL00470:Zswim8	APN	14	20723181	missense	probably damaging	1.00
IGL00675:Zswim8	APN	14	20716901	unclassified	probably benign
IGL00896:Zswim8	APN	14	20716001	missense	probably damaging	1.00
IGL01343:Zswim8	APN	14	20713341	missense	probably damaging	1.00
IGL01736:Zswim8	APN	14	20714712	missense	probably benign	0.11
IGL01961:Zswim8	APN	14	20712334	missense	possibly damaging	0.76
IGL02331:Zswim8	APN	14	20723257	missense	probably damaging	1.00
IGL02485:Zswim8	APN	14	20711887	missense	probably damaging	0.98
IGL02662:Zswim8	APN	14	20713074	missense	probably benign	0.14
IGL03001:Zswim8	APN	14	20714391	missense	probably damaging	1.00
pool	UTSW	14	20714573	splice site	probably null
R0123:Zswim8	UTSW	14	20716490	splice site	probably benign
R0362:Zswim8	UTSW	14	20721945	missense	possibly damaging	0.58
R0402:Zswim8	UTSW	14	20710766	missense	probably damaging	1.00
R0458:Zswim8	UTSW	14	20718897	missense	probably damaging	1.00
R1087:Zswim8	UTSW	14	20717865	splice site	probably null
R1158:Zswim8	UTSW	14	20721668	splice site	probably benign
R1171:Zswim8	UTSW	14	20713113	missense	possibly damaging	0.94
R1389:Zswim8	UTSW	14	20710748	missense	probably damaging	1.00
R1773:Zswim8	UTSW	14	20711530	missense	probably damaging	0.96
R1780:Zswim8	UTSW	14	20716327	missense	probably damaging	0.99
R1850:Zswim8	UTSW	14	20710747	nonsense	probably null
R2421:Zswim8	UTSW	14	20719457	missense	probably damaging	1.00
R3826:Zswim8	UTSW	14	20711089	nonsense	probably null
R3965:Zswim8	UTSW	14	20713073	missense	probably benign
R4301:Zswim8	UTSW	14	20713909	missense	possibly damaging	0.91
R4499:Zswim8	UTSW	14	20714297	missense	probably benign	0.05
R4633:Zswim8	UTSW	14	20718823	missense	probably damaging	1.00
R4675:Zswim8	UTSW	14	20714613	missense	probably benign
R4958:Zswim8	UTSW	14	20713465	missense	probably damaging	1.00
R5255:Zswim8	UTSW	14	20721651	missense	probably damaging	1.00
R5288:Zswim8	UTSW	14	20718871	missense	possibly damaging	0.92
R5341:Zswim8	UTSW	14	20716054	missense	probably damaging	1.00
R5495:Zswim8	UTSW	14	20722286	missense	probably damaging	0.97
R5652:Zswim8	UTSW	14	20713427	missense	possibly damaging	0.62
R6273:Zswim8	UTSW	14	20713453	missense	probably benign	0.06
R6281:Zswim8	UTSW	14	20714640	missense	probably benign	0.02
R6364:Zswim8	UTSW	14	20713011	missense	probably damaging	1.00
R6426:Zswim8	UTSW	14	20718526	missense	probably damaging	0.99
R6576:Zswim8	UTSW	14	20721874	missense	probably benign	0.41
R6798:Zswim8	UTSW	14	20715992	missense	probably damaging	1.00
R7059:Zswim8	UTSW	14	20714573	splice site	probably null
R7243:Zswim8	UTSW	14	20714368	missense	probably damaging	1.00
R7250:Zswim8	UTSW	14	20719968	missense	probably damaging	1.00
R7311:Zswim8	UTSW	14	20721484	missense	probably damaging	1.00
R7567:Zswim8	UTSW	14	20719933	missense	probably damaging	1.00
R7635:Zswim8	UTSW	14	20716300	missense	probably damaging	0.99
R7874:Zswim8	UTSW	14	20723149	missense	probably damaging	0.98
R7994:Zswim8	UTSW	14	20708004	missense	possibly damaging	0.95
R8466:Zswim8	UTSW	14	20710676	missense	possibly damaging	0.93
R9019:Zswim8	UTSW	14	20711051	missense	probably damaging	1.00
R9177:Zswim8	UTSW	14	20711840	missense	probably damaging	1.00
R9192:Zswim8	UTSW	14	20719520	missense	probably damaging	1.00
R9229:Zswim8	UTSW	14	20716325	missense	probably benign	0.45
R9268:Zswim8	UTSW	14	20711840	missense	probably damaging	1.00
R9562:Zswim8	UTSW	14	20712082	nonsense	probably null
R9589:Zswim8	UTSW	14	20713103	missense	probably damaging	0.99
R9621:Zswim8	UTSW	14	20722163	missense	probably benign	0.00
X0026:Zswim8	UTSW	14	20710632	splice site	probably null
X0028:Zswim8	UTSW	14	20714657	missense	probably benign	0.19
X0058:Zswim8	UTSW	14	20712990	missense	probably damaging	0.99
Z1177:Zswim8	UTSW	14	20713044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGGACAGTCAGTGATTTCC -3'
(R):5'- AGTGAGTATTTCCAGCAAGGGG -3'

Sequencing Primer
(F):5'- ACAGTCAGTGATTTCCTATTTGCG -3'
(R):5'- TTCCAGCAAGGGGGCAGC -3'

Posted On

2019-11-26