Incidental Mutation 'R7771:Zswim8'
ID598595
Institutional Source Beutler Lab
Gene Symbol Zswim8
Ensembl Gene ENSMUSG00000021819
Gene Namezinc finger SWIM-type containing 8
Synonyms2310021P13Rik, 4832404P21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7771 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location20707552-20723619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20712980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 316 (V316I)
Ref Sequence ENSEMBL: ENSMUSP00000022358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000223840] [ENSMUST00000224129] [ENSMUST00000224751]
Predicted Effect probably damaging
Transcript: ENSMUST00000022358
AA Change: V316I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819
AA Change: V316I

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223840
AA Change: V316I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000224129
Predicted Effect possibly damaging
Transcript: ENSMUST00000224751
AA Change: V316I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Other mutations in Zswim8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zswim8 APN 14 20718475 missense probably damaging 0.99
IGL00470:Zswim8 APN 14 20723181 missense probably damaging 1.00
IGL00675:Zswim8 APN 14 20716901 unclassified probably benign
IGL00896:Zswim8 APN 14 20716001 missense probably damaging 1.00
IGL01343:Zswim8 APN 14 20713341 missense probably damaging 1.00
IGL01736:Zswim8 APN 14 20714712 missense probably benign 0.11
IGL01961:Zswim8 APN 14 20712334 missense possibly damaging 0.76
IGL02331:Zswim8 APN 14 20723257 missense probably damaging 1.00
IGL02485:Zswim8 APN 14 20711887 missense probably damaging 0.98
IGL02662:Zswim8 APN 14 20713074 missense probably benign 0.14
IGL03001:Zswim8 APN 14 20714391 missense probably damaging 1.00
pool UTSW 14 20714573 splice site probably null
R0123:Zswim8 UTSW 14 20716490 splice site probably benign
R0362:Zswim8 UTSW 14 20721945 missense possibly damaging 0.58
R0402:Zswim8 UTSW 14 20710766 missense probably damaging 1.00
R0458:Zswim8 UTSW 14 20718897 missense probably damaging 1.00
R1087:Zswim8 UTSW 14 20717865 splice site probably null
R1158:Zswim8 UTSW 14 20721668 splice site probably benign
R1171:Zswim8 UTSW 14 20713113 missense possibly damaging 0.94
R1389:Zswim8 UTSW 14 20710748 missense probably damaging 1.00
R1773:Zswim8 UTSW 14 20711530 missense probably damaging 0.96
R1780:Zswim8 UTSW 14 20716327 missense probably damaging 0.99
R1850:Zswim8 UTSW 14 20710747 nonsense probably null
R2421:Zswim8 UTSW 14 20719457 missense probably damaging 1.00
R3826:Zswim8 UTSW 14 20711089 nonsense probably null
R3965:Zswim8 UTSW 14 20713073 missense probably benign
R4301:Zswim8 UTSW 14 20713909 missense possibly damaging 0.91
R4499:Zswim8 UTSW 14 20714297 missense probably benign 0.05
R4633:Zswim8 UTSW 14 20718823 missense probably damaging 1.00
R4675:Zswim8 UTSW 14 20714613 missense probably benign
R4958:Zswim8 UTSW 14 20713465 missense probably damaging 1.00
R5255:Zswim8 UTSW 14 20721651 missense probably damaging 1.00
R5288:Zswim8 UTSW 14 20718871 missense possibly damaging 0.92
R5341:Zswim8 UTSW 14 20716054 missense probably damaging 1.00
R5495:Zswim8 UTSW 14 20722286 missense probably damaging 0.97
R5652:Zswim8 UTSW 14 20713427 missense possibly damaging 0.62
R6273:Zswim8 UTSW 14 20713453 missense probably benign 0.06
R6281:Zswim8 UTSW 14 20714640 missense probably benign 0.02
R6364:Zswim8 UTSW 14 20713011 missense probably damaging 1.00
R6426:Zswim8 UTSW 14 20718526 missense probably damaging 0.99
R6576:Zswim8 UTSW 14 20721874 missense probably benign 0.41
R6798:Zswim8 UTSW 14 20715992 missense probably damaging 1.00
R7059:Zswim8 UTSW 14 20714573 splice site probably null
R7243:Zswim8 UTSW 14 20714368 missense probably damaging 1.00
R7250:Zswim8 UTSW 14 20719968 missense probably damaging 1.00
R7311:Zswim8 UTSW 14 20721484 missense probably damaging 1.00
R7567:Zswim8 UTSW 14 20719933 missense probably damaging 1.00
R7635:Zswim8 UTSW 14 20716300 missense probably damaging 0.99
R7874:Zswim8 UTSW 14 20723149 missense probably damaging 0.98
R7957:Zswim8 UTSW 14 20723149 missense probably damaging 0.98
X0026:Zswim8 UTSW 14 20710632 splice site probably null
X0028:Zswim8 UTSW 14 20714657 missense probably benign 0.19
X0058:Zswim8 UTSW 14 20712990 missense probably damaging 0.99
Z1177:Zswim8 UTSW 14 20713044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGACAGTCAGTGATTTCC -3'
(R):5'- AGTGAGTATTTCCAGCAAGGGG -3'

Sequencing Primer
(F):5'- ACAGTCAGTGATTTCCTATTTGCG -3'
(R):5'- TTCCAGCAAGGGGGCAGC -3'
Posted On2019-11-26