Incidental Mutation 'R7771:Fam208a'
ID598596
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27467559 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 923 (T923A)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably damaging
Transcript: ENSMUST00000022450
AA Change: T923A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: T923A

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
R7580:Fam208a UTSW 14 27466286 missense probably benign 0.29
R7726:Fam208a UTSW 14 27447497 missense probably damaging 0.99
R7782:Fam208a UTSW 14 27471944 missense probably benign 0.07
R7795:Fam208a UTSW 14 27481383 missense
R7835:Fam208a UTSW 14 27476643 missense probably damaging 1.00
R7918:Fam208a UTSW 14 27476643 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Z1176:Fam208a UTSW 14 27429208 missense probably damaging 0.97
Z1176:Fam208a UTSW 14 27477148 missense probably damaging 1.00
Z1177:Fam208a UTSW 14 27448250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCACCTGAGTGGAAAGG -3'
(R):5'- GTCACCCGATCAGATAGACAAG -3'

Sequencing Primer
(F):5'- CCTGAGTGGAAAGGGAAACAACTTC -3'
(R):5'- ATGTGTGTAACAAAAACATGTGATAC -3'
Posted On2019-11-26