Incidental Mutation 'R7771:Derl1'
ID598600
Institutional Source Beutler Lab
Gene Symbol Derl1
Ensembl Gene ENSMUSG00000022365
Gene NameDer1-like domain family, member 1
Synonyms1110021N07Rik, Derlin-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location57869502-57892448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57880040 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 97 (D97G)
Ref Sequence ENSEMBL: ENSMUSP00000022993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022993]
Predicted Effect probably damaging
Transcript: ENSMUST00000022993
AA Change: D97G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022993
Gene: ENSMUSG00000022365
AA Change: D97G

DomainStartEndE-ValueType
Pfam:DER1 11 204 1.7e-68 PFAM
low complexity region 233 245 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This protein recognizes substrate in the ER and works in a complex to retrotranslocate it across the ER membrane into the cytosol. This protein may select cystic fibrosis transmembrane conductance regulator protein (CFTR) for degradation as well as unfolded proteins in Alzheimer's disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality during embryogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Derl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Derl1 APN 15 57892147 missense possibly damaging 0.94
R1643:Derl1 UTSW 15 57878559 missense probably benign
R3081:Derl1 UTSW 15 57875611 splice site probably benign
R7034:Derl1 UTSW 15 57879047 critical splice donor site probably null
R7036:Derl1 UTSW 15 57879047 critical splice donor site probably null
R7996:Derl1 UTSW 15 57878574 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCCAGTGAGAGAAGGCATC -3'
(R):5'- GTGCTCCTATGTCCCAAAGG -3'

Sequencing Primer
(F):5'- GGATTTACCCTGGCTTCAAAGAC -3'
(R):5'- ATGTCCCAAAGGTCACACTTTTTG -3'
Posted On2019-11-26