Incidental Mutation 'R7771:Cyp2d26'
ID598601
Institutional Source Beutler Lab
Gene Symbol Cyp2d26
Ensembl Gene ENSMUSG00000022445
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 26
Synonyms1300006E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82790101-82794294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82791746 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 255 (N255S)
Ref Sequence ENSEMBL: ENSMUSP00000006094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006094] [ENSMUST00000229387] [ENSMUST00000229512]
Predicted Effect probably benign
Transcript: ENSMUST00000006094
AA Change: N255S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006094
Gene: ENSMUSG00000022445
AA Change: N255S

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:p450 37 497 3.5e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229387
Predicted Effect probably benign
Transcript: ENSMUST00000229512
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Cyp2d26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cyp2d26 APN 15 82791043 missense probably benign 0.31
IGL00670:Cyp2d26 APN 15 82791741 missense probably benign
IGL01646:Cyp2d26 APN 15 82791418 missense probably benign 0.00
IGL01915:Cyp2d26 APN 15 82790249 missense probably benign 0.06
IGL01940:Cyp2d26 APN 15 82792557 missense probably benign 0.00
IGL02127:Cyp2d26 APN 15 82791106 missense probably benign 0.09
IGL02452:Cyp2d26 APN 15 82792626 missense probably benign 0.00
IGL03216:Cyp2d26 APN 15 82793261 missense probably benign
IGL03377:Cyp2d26 APN 15 82790554 missense possibly damaging 0.47
R0149:Cyp2d26 UTSW 15 82792767 missense probably damaging 1.00
R0848:Cyp2d26 UTSW 15 82790233 missense probably benign 0.00
R1165:Cyp2d26 UTSW 15 82794041 missense probably damaging 1.00
R1217:Cyp2d26 UTSW 15 82792867 splice site probably benign
R1780:Cyp2d26 UTSW 15 82794007 missense probably damaging 1.00
R2048:Cyp2d26 UTSW 15 82792727 utr 3 prime probably benign
R2152:Cyp2d26 UTSW 15 82792706 critical splice donor site probably null
R2397:Cyp2d26 UTSW 15 82794035 missense probably damaging 1.00
R4702:Cyp2d26 UTSW 15 82792447 intron probably benign
R5157:Cyp2d26 UTSW 15 82790989 missense probably benign 0.01
R5444:Cyp2d26 UTSW 15 82792538 missense probably benign 0.18
R6017:Cyp2d26 UTSW 15 82790573 missense possibly damaging 0.68
R6223:Cyp2d26 UTSW 15 82791717 missense probably benign 0.04
R6390:Cyp2d26 UTSW 15 82792624 missense possibly damaging 0.68
R6473:Cyp2d26 UTSW 15 82791767 missense probably benign 0.02
R6858:Cyp2d26 UTSW 15 82794083 missense probably damaging 1.00
R6912:Cyp2d26 UTSW 15 82791119 missense probably benign 0.16
R6936:Cyp2d26 UTSW 15 82792540 missense probably benign 0.14
R6960:Cyp2d26 UTSW 15 82790245 missense probably damaging 0.98
R7053:Cyp2d26 UTSW 15 82792600 missense probably benign 0.00
R7113:Cyp2d26 UTSW 15 82790202 missense probably benign 0.02
R7126:Cyp2d26 UTSW 15 82794008 missense probably benign 0.00
R7272:Cyp2d26 UTSW 15 82792563 missense probably benign
R8695:Cyp2d26 UTSW 15 82792706 critical splice donor site probably benign
X0021:Cyp2d26 UTSW 15 82790517 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAGTCACTTGGTGATGCACAG -3'
(R):5'- ACATGAGTCACTATATACAGGCAAG -3'

Sequencing Primer
(F):5'- ACTTGGTGATGCACAGGACTCTAC -3'
(R):5'- CTATATACAGGCAAGCACATGTG -3'
Posted On2019-11-26