Incidental Mutation 'R7771:Ccdc116'
ID598602
Institutional Source Beutler Lab
Gene Symbol Ccdc116
Ensembl Gene ENSMUSG00000022768
Gene Namecoiled-coil domain containing 116
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7771 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17139064-17147229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17139591 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 568 (E568G)
Ref Sequence ENSEMBL: ENSMUSP00000156301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023452] [ENSMUST00000115711] [ENSMUST00000231597] [ENSMUST00000232033] [ENSMUST00000232540]
Predicted Effect probably benign
Transcript: ENSMUST00000023452
SMART Domains Protein: ENSMUSP00000023452
Gene: ENSMUSG00000022768

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115711
SMART Domains Protein: ENSMUSP00000111376
Gene: ENSMUSG00000022768

DomainStartEndE-ValueType
Pfam:DUF4702 18 411 6.3e-223 PFAM
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231597
Predicted Effect probably benign
Transcript: ENSMUST00000232033
Predicted Effect probably benign
Transcript: ENSMUST00000232540
AA Change: E568G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Itgb2l A G 16: 96,426,972 C444R probably damaging Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Ccdc116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ccdc116 APN 16 17141992 missense probably damaging 1.00
IGL01905:Ccdc116 APN 16 17142561 missense probably damaging 0.99
IGL02751:Ccdc116 APN 16 17141972 missense probably benign 0.00
IGL03183:Ccdc116 APN 16 17142854 missense probably benign 0.07
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0122:Ccdc116 UTSW 16 17142734 missense probably damaging 1.00
R0219:Ccdc116 UTSW 16 17141612 missense possibly damaging 0.93
R1664:Ccdc116 UTSW 16 17142628 missense probably benign 0.02
R1718:Ccdc116 UTSW 16 17141908 missense probably benign
R2921:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2922:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2923:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R4119:Ccdc116 UTSW 16 17142187 missense probably damaging 1.00
R4223:Ccdc116 UTSW 16 17146945 unclassified probably benign
R5000:Ccdc116 UTSW 16 17141793 missense possibly damaging 0.95
R5293:Ccdc116 UTSW 16 17141787 missense possibly damaging 0.92
R5435:Ccdc116 UTSW 16 17142762 missense probably benign 0.38
R6694:Ccdc116 UTSW 16 17142791 missense probably benign 0.44
R7215:Ccdc116 UTSW 16 17139928 missense probably damaging 1.00
R7247:Ccdc116 UTSW 16 17139691 missense possibly damaging 0.89
Z1088:Ccdc116 UTSW 16 17147171 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTTCTCCAACTCATGCAAAGG -3'
(R):5'- TTGTCACAGCAGGCCCTAAG -3'

Sequencing Primer
(F):5'- CTCATGCAAAGGCGGGCTAG -3'
(R):5'- GCAGGCCCTAAGACATGC -3'
Posted On2019-11-26