Incidental Mutation 'R7771:Itgb2l'
ID598603
Institutional Source Beutler Lab
Gene Symbol Itgb2l
Ensembl Gene ENSMUSG00000000157
Gene Nameintegrin beta 2-like
Synonymspactolus, 5033406G21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7771 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location96422288-96443619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96426972 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 444 (C444R)
Ref Sequence ENSEMBL: ENSMUSP00000109403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113794] [ENSMUST00000113795] [ENSMUST00000131567]
Predicted Effect probably damaging
Transcript: ENSMUST00000000161
AA Change: C444R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: C444R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113773
AA Change: C444R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: C444R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113794
SMART Domains Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 127 9.63e-6 SMART
IG 134 221 2.64e0 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131567
AA Change: C444R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157
AA Change: C444R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,239,191 A1287T probably damaging Het
Ahnak A G 19: 9,015,047 K4565R probably damaging Het
Asb13 A G 13: 3,649,463 Y221C probably damaging Het
BB014433 C T 8: 15,042,395 V153M probably damaging Het
Brip1 T C 11: 86,062,024 E977G probably benign Het
C3 T A 17: 57,215,797 D1029V probably damaging Het
Ccdc116 T C 16: 17,139,591 E568G probably benign Het
Cdhr2 T C 13: 54,718,275 V296A probably damaging Het
Cenpe A G 3: 135,240,941 probably null Het
Cnot1 A G 8: 95,765,125 V357A probably damaging Het
Coa3 A T 11: 101,278,815 M38K possibly damaging Het
Cyp2d26 T C 15: 82,791,746 N255S probably benign Het
Cysrt1 T C 2: 25,239,225 S92G probably benign Het
D030056L22Rik A G 19: 18,713,478 E52G possibly damaging Het
Derl1 T C 15: 57,880,040 D97G probably damaging Het
Ebf3 A G 7: 137,309,363 Y141H probably damaging Het
Eci1 T A 17: 24,433,151 L49* probably null Het
Fam208a A G 14: 27,467,559 T923A probably damaging Het
Gm7534 A T 4: 134,195,443 N526K probably benign Het
Gzma C T 13: 113,098,295 C54Y probably damaging Het
Hydin A G 8: 110,565,085 N3403S probably damaging Het
Ide T C 19: 37,298,126 N495D Het
Ighv1-23 T A 12: 114,764,736 Q22L probably benign Het
Kcnj3 C A 2: 55,446,937 H272N probably damaging Het
Lrp6 C T 6: 134,462,616 C1218Y probably damaging Het
Lrrd1 T C 5: 3,866,476 M831T possibly damaging Het
Map3k11 A G 19: 5,690,608 E121G probably damaging Het
Mzt1 A T 14: 99,040,576 I52N probably damaging Het
Olfr339 T C 2: 36,422,144 S249P possibly damaging Het
Olfr617 A G 7: 103,584,090 I23V probably benign Het
Olfr857 T A 9: 19,713,471 F215I probably benign Het
Pcdhb17 A C 18: 37,486,909 Y584S possibly damaging Het
Per3 A T 4: 151,026,200 D380E probably damaging Het
Per3 A T 4: 151,041,445 L139Q probably damaging Het
Pik3cg T C 12: 32,204,014 H658R probably benign Het
Pitpnm3 G A 11: 72,061,488 Q626* probably null Het
Polr3e T C 7: 120,940,578 V542A probably benign Het
Rgs22 T A 15: 36,050,078 H866L possibly damaging Het
Rnf150 A G 8: 82,864,203 E65G probably benign Het
Sema3f C A 9: 107,692,426 R100L possibly damaging Het
Smim18 T C 8: 33,742,342 D83G possibly damaging Het
Snx13 T A 12: 35,124,528 D685E probably benign Het
Stat5a A C 11: 100,863,219 N125T probably benign Het
Stk24 T C 14: 121,337,633 E21G probably damaging Het
Tlr3 C T 8: 45,403,039 V35I probably benign Het
Tmem8 T C 17: 26,122,073 Y717H probably damaging Het
Tmprss11b A T 5: 86,661,695 probably null Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc37 A G 13: 76,135,030 H792R probably benign Het
Ttc39a T C 4: 109,431,450 Y276H probably damaging Het
Vmn2r98 T A 17: 19,067,198 probably null Het
Wdr73 G A 7: 80,893,227 A211V probably benign Het
Zc3h4 T C 7: 16,429,899 V673A unknown Het
Zfp382 A G 7: 30,133,335 H137R probably damaging Het
Zp2 T G 7: 120,143,642 D89A probably damaging Het
Zranb3 A C 1: 128,032,868 Y220D probably damaging Het
Zswim8 G A 14: 20,712,980 V316I probably damaging Het
Other mutations in Itgb2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Itgb2l APN 16 96426750 missense probably damaging 0.98
IGL01482:Itgb2l APN 16 96438748 missense probably damaging 0.99
IGL01767:Itgb2l APN 16 96430575 missense probably benign 0.05
IGL02056:Itgb2l APN 16 96427689 missense probably damaging 0.97
IGL02072:Itgb2l APN 16 96430608 missense probably benign
IGL02858:Itgb2l APN 16 96422650 missense possibly damaging 0.96
R0011:Itgb2l UTSW 16 96427661 splice site probably benign
R0153:Itgb2l UTSW 16 96437369 missense possibly damaging 0.94
R0270:Itgb2l UTSW 16 96422930 unclassified probably benign
R0496:Itgb2l UTSW 16 96434701 missense possibly damaging 0.86
R0627:Itgb2l UTSW 16 96422911 unclassified probably benign
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1509:Itgb2l UTSW 16 96426849 missense probably benign 0.28
R1792:Itgb2l UTSW 16 96425082 missense probably damaging 1.00
R1912:Itgb2l UTSW 16 96426935 missense probably benign 0.17
R2210:Itgb2l UTSW 16 96426221 missense possibly damaging 0.82
R3160:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3162:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3836:Itgb2l UTSW 16 96426167 missense probably benign
R4131:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4132:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4254:Itgb2l UTSW 16 96430577 missense probably benign 0.00
R4854:Itgb2l UTSW 16 96426117 nonsense probably null
R4893:Itgb2l UTSW 16 96427821 missense probably benign 0.12
R4931:Itgb2l UTSW 16 96437449 missense probably damaging 1.00
R5039:Itgb2l UTSW 16 96425005 missense possibly damaging 0.69
R5055:Itgb2l UTSW 16 96427803 missense probably damaging 1.00
R5960:Itgb2l UTSW 16 96426259 missense probably benign 0.00
R6412:Itgb2l UTSW 16 96427729 missense probably benign 0.04
R6966:Itgb2l UTSW 16 96430643 missense probably benign 0.02
R7149:Itgb2l UTSW 16 96433559 missense probably damaging 1.00
R7278:Itgb2l UTSW 16 96429043 missense probably damaging 1.00
R7293:Itgb2l UTSW 16 96426796 nonsense probably null
R7482:Itgb2l UTSW 16 96426833 missense probably benign 0.01
R7570:Itgb2l UTSW 16 96426239 missense probably benign 0.00
R7743:Itgb2l UTSW 16 96437408 missense probably damaging 1.00
X0018:Itgb2l UTSW 16 96435676 missense probably benign 0.01
Z1177:Itgb2l UTSW 16 96437356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATAGATCTCTTTGTTGGG -3'
(R):5'- CGCAAGGTCAAGCTTATGC -3'

Sequencing Primer
(F):5'- ATAGATCTCTTTGTTGGGGATGTCAC -3'
(R):5'- ATGCTTGGCCACTCTACTAAGGG -3'
Posted On2019-11-26