Incidental Mutation 'R7771:Ahnak'
ID 598609
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene Name AHNAK nucleoprotein
Synonyms DY6, 1110004P15Rik, 2310047C17Rik
MMRRC Submission 045827-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R7771 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 8966648-9054278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8992411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 4565 (K4565R)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092956
AA Change: K4565R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: K4565R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Meta Mutation Damage Score 0.1053 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,069,535 (GRCm39) A1287T probably damaging Het
Asb13 A G 13: 3,699,463 (GRCm39) Y221C probably damaging Het
BB014433 C T 8: 15,092,395 (GRCm39) V153M probably damaging Het
Brip1 T C 11: 85,952,850 (GRCm39) E977G probably benign Het
C3 T A 17: 57,522,797 (GRCm39) D1029V probably damaging Het
Ccdc116 T C 16: 16,957,455 (GRCm39) E568G probably benign Het
Cdhr2 T C 13: 54,866,088 (GRCm39) V296A probably damaging Het
Cenpe A G 3: 134,946,702 (GRCm39) probably null Het
Cnot1 A G 8: 96,491,753 (GRCm39) V357A probably damaging Het
Coa3 A T 11: 101,169,641 (GRCm39) M38K possibly damaging Het
Cyp2d26 T C 15: 82,675,947 (GRCm39) N255S probably benign Het
Cysrt1 T C 2: 25,129,237 (GRCm39) S92G probably benign Het
D030056L22Rik A G 19: 18,690,842 (GRCm39) E52G possibly damaging Het
Derl1 T C 15: 57,743,436 (GRCm39) D97G probably damaging Het
Ebf3 A G 7: 136,911,092 (GRCm39) Y141H probably damaging Het
Eci1 T A 17: 24,652,125 (GRCm39) L49* probably null Het
Gzma C T 13: 113,234,829 (GRCm39) C54Y probably damaging Het
Hydin A G 8: 111,291,717 (GRCm39) N3403S probably damaging Het
Ide T C 19: 37,275,525 (GRCm39) N495D Het
Ighv1-23 T A 12: 114,728,356 (GRCm39) Q22L probably benign Het
Itgb2l A G 16: 96,228,172 (GRCm39) C444R probably damaging Het
Kcnj3 C A 2: 55,336,949 (GRCm39) H272N probably damaging Het
Lrp6 C T 6: 134,439,579 (GRCm39) C1218Y probably damaging Het
Lrrd1 T C 5: 3,916,476 (GRCm39) M831T possibly damaging Het
Map3k11 A G 19: 5,740,636 (GRCm39) E121G probably damaging Het
Mzt1 A T 14: 99,278,012 (GRCm39) I52N probably damaging Het
Or1j11 T C 2: 36,312,156 (GRCm39) S249P possibly damaging Het
Or52z12 A G 7: 103,233,297 (GRCm39) I23V probably benign Het
Or7e166 T A 9: 19,624,767 (GRCm39) F215I probably benign Het
Pcdhb17 A C 18: 37,619,962 (GRCm39) Y584S possibly damaging Het
Per3 A T 4: 151,110,657 (GRCm39) D380E probably damaging Het
Per3 A T 4: 151,125,902 (GRCm39) L139Q probably damaging Het
Pgap6 T C 17: 26,341,047 (GRCm39) Y717H probably damaging Het
Pik3cg T C 12: 32,254,013 (GRCm39) H658R probably benign Het
Pitpnm3 G A 11: 71,952,314 (GRCm39) Q626* probably null Het
Polr3e T C 7: 120,539,801 (GRCm39) V542A probably benign Het
Rgs22 T A 15: 36,050,224 (GRCm39) H866L possibly damaging Het
Rnf150 A G 8: 83,590,832 (GRCm39) E65G probably benign Het
Sema3f C A 9: 107,569,625 (GRCm39) R100L possibly damaging Het
Skic3 A G 13: 76,283,149 (GRCm39) H792R probably benign Het
Smim18 T C 8: 34,232,370 (GRCm39) D83G possibly damaging Het
Snx13 T A 12: 35,174,527 (GRCm39) D685E probably benign Het
Stat5a A C 11: 100,754,045 (GRCm39) N125T probably benign Het
Stk24 T C 14: 121,575,045 (GRCm39) E21G probably damaging Het
Tasor A G 14: 27,189,516 (GRCm39) T923A probably damaging Het
Tlr3 C T 8: 45,856,076 (GRCm39) V35I probably benign Het
Tmprss11b A T 5: 86,809,554 (GRCm39) probably null Het
Trpm2 T C 10: 77,768,013 (GRCm39) I829V probably benign Het
Ttc39a T C 4: 109,288,647 (GRCm39) Y276H probably damaging Het
Vmn2r98 T A 17: 19,287,460 (GRCm39) probably null Het
Wdr73 G A 7: 80,542,975 (GRCm39) A211V probably benign Het
Zc3h4 T C 7: 16,163,824 (GRCm39) V673A unknown Het
Zfp382 A G 7: 29,832,760 (GRCm39) H137R probably damaging Het
Zp2 T G 7: 119,742,865 (GRCm39) D89A probably damaging Het
Zpld2 A T 4: 133,922,754 (GRCm39) N526K probably benign Het
Zranb3 A C 1: 127,960,605 (GRCm39) Y220D probably damaging Het
Zswim8 G A 14: 20,763,048 (GRCm39) V316I probably damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 8,984,587 (GRCm39) missense probably damaging 0.99
IGL00509:Ahnak APN 19 8,987,315 (GRCm39) missense possibly damaging 0.94
IGL00539:Ahnak APN 19 8,985,272 (GRCm39) missense possibly damaging 0.50
IGL00558:Ahnak APN 19 8,981,671 (GRCm39) missense possibly damaging 0.93
IGL00567:Ahnak APN 19 8,990,747 (GRCm39) missense probably benign 0.24
IGL00706:Ahnak APN 19 8,991,094 (GRCm39) nonsense probably null
IGL00807:Ahnak APN 19 8,985,886 (GRCm39) missense possibly damaging 0.92
IGL00870:Ahnak APN 19 8,991,062 (GRCm39) missense probably damaging 1.00
IGL01101:Ahnak APN 19 8,990,251 (GRCm39) intron probably benign
IGL01118:Ahnak APN 19 8,989,942 (GRCm39) missense probably damaging 1.00
IGL01288:Ahnak APN 19 8,979,858 (GRCm39) missense possibly damaging 0.94
IGL01324:Ahnak APN 19 8,980,396 (GRCm39) missense probably damaging 1.00
IGL01341:Ahnak APN 19 8,989,067 (GRCm39) missense probably benign
IGL01541:Ahnak APN 19 8,985,243 (GRCm39) missense possibly damaging 0.95
IGL01580:Ahnak APN 19 8,980,203 (GRCm39) missense probably benign 0.02
IGL01595:Ahnak APN 19 8,980,865 (GRCm39) nonsense probably null
IGL01746:Ahnak APN 19 8,982,276 (GRCm39) missense possibly damaging 0.89
IGL01766:Ahnak APN 19 8,977,482 (GRCm39) missense unknown
IGL01821:Ahnak APN 19 8,989,482 (GRCm39) missense probably benign
IGL01913:Ahnak APN 19 8,983,428 (GRCm39) nonsense probably null
IGL01934:Ahnak APN 19 8,980,021 (GRCm39) missense probably damaging 1.00
IGL01940:Ahnak APN 19 8,983,921 (GRCm39) missense probably benign 0.14
IGL01958:Ahnak APN 19 8,992,273 (GRCm39) missense possibly damaging 0.59
IGL02145:Ahnak APN 19 8,980,219 (GRCm39) missense probably benign 0.11
IGL02246:Ahnak APN 19 8,985,632 (GRCm39) missense probably damaging 1.00
IGL02282:Ahnak APN 19 8,983,351 (GRCm39) missense probably damaging 1.00
IGL02428:Ahnak APN 19 8,992,197 (GRCm39) missense possibly damaging 0.83
IGL02442:Ahnak APN 19 8,981,380 (GRCm39) missense probably damaging 1.00
IGL02474:Ahnak APN 19 8,982,297 (GRCm39) missense probably benign 0.13
IGL02483:Ahnak APN 19 8,980,672 (GRCm39) missense probably benign 0.01
IGL02616:Ahnak APN 19 8,982,991 (GRCm39) missense probably benign 0.03
IGL02630:Ahnak APN 19 8,989,441 (GRCm39) missense probably damaging 1.00
IGL02690:Ahnak APN 19 8,989,948 (GRCm39) nonsense probably null
IGL02717:Ahnak APN 19 8,979,751 (GRCm39) missense probably benign 0.00
IGL02721:Ahnak APN 19 8,987,071 (GRCm39) missense probably benign 0.07
IGL02737:Ahnak APN 19 8,981,957 (GRCm39) missense probably benign 0.17
IGL02850:Ahnak APN 19 8,979,960 (GRCm39) missense probably benign 0.00
IGL03071:Ahnak APN 19 8,989,282 (GRCm39) missense possibly damaging 0.63
IGL03072:Ahnak APN 19 8,983,872 (GRCm39) missense probably benign 0.11
IGL03094:Ahnak APN 19 8,980,911 (GRCm39) missense possibly damaging 0.64
IGL03140:Ahnak APN 19 8,982,576 (GRCm39) intron probably benign
IGL03176:Ahnak APN 19 8,979,813 (GRCm39) missense probably damaging 1.00
IGL03176:Ahnak APN 19 8,985,530 (GRCm39) missense possibly damaging 0.56
IGL03189:Ahnak APN 19 8,988,603 (GRCm39) missense possibly damaging 0.65
IGL03357:Ahnak APN 19 8,986,689 (GRCm39) intron probably benign
IGL03371:Ahnak APN 19 8,981,592 (GRCm39) missense possibly damaging 0.91
Eskimo UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
Nanook UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
Netsilik UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
IGL03097:Ahnak UTSW 19 8,979,751 (GRCm39) missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 8,983,540 (GRCm39) missense possibly damaging 0.87
R0054:Ahnak UTSW 19 8,989,420 (GRCm39) missense probably damaging 1.00
R0094:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R0110:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0141:Ahnak UTSW 19 8,984,044 (GRCm39) missense probably damaging 1.00
R0166:Ahnak UTSW 19 8,983,089 (GRCm39) missense probably damaging 1.00
R0309:Ahnak UTSW 19 8,979,859 (GRCm39) missense probably damaging 1.00
R0368:Ahnak UTSW 19 8,985,714 (GRCm39) nonsense probably null
R0386:Ahnak UTSW 19 8,988,508 (GRCm39) missense possibly damaging 0.94
R0401:Ahnak UTSW 19 8,992,480 (GRCm39) missense probably benign 0.24
R0415:Ahnak UTSW 19 8,990,235 (GRCm39) intron probably benign
R0463:Ahnak UTSW 19 8,986,771 (GRCm39) intron probably benign
R0469:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0470:Ahnak UTSW 19 8,986,331 (GRCm39) missense probably benign 0.29
R0487:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R0487:Ahnak UTSW 19 8,984,515 (GRCm39) missense probably benign 0.00
R0499:Ahnak UTSW 19 8,977,628 (GRCm39) splice site probably benign
R0506:Ahnak UTSW 19 8,986,492 (GRCm39) missense probably damaging 1.00
R0510:Ahnak UTSW 19 8,995,596 (GRCm39) nonsense probably null
R0557:Ahnak UTSW 19 8,979,308 (GRCm39) missense probably benign 0.10
R0570:Ahnak UTSW 19 8,991,062 (GRCm39) missense probably damaging 1.00
R0610:Ahnak UTSW 19 8,985,242 (GRCm39) missense probably benign 0.08
R0646:Ahnak UTSW 19 8,990,766 (GRCm39) nonsense probably null
R0659:Ahnak UTSW 19 8,992,366 (GRCm39) missense possibly damaging 0.60
R0791:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0792:Ahnak UTSW 19 8,994,098 (GRCm39) missense probably benign 0.01
R0840:Ahnak UTSW 19 8,982,427 (GRCm39) missense probably damaging 1.00
R0847:Ahnak UTSW 19 8,983,797 (GRCm39) nonsense probably null
R0941:Ahnak UTSW 19 8,987,278 (GRCm39) missense probably damaging 1.00
R0962:Ahnak UTSW 19 8,990,212 (GRCm39) intron probably benign
R1017:Ahnak UTSW 19 8,987,907 (GRCm39) missense probably damaging 0.99
R1037:Ahnak UTSW 19 8,984,982 (GRCm39) missense probably benign 0.27
R1085:Ahnak UTSW 19 8,990,489 (GRCm39) missense possibly damaging 0.50
R1113:Ahnak UTSW 19 8,982,984 (GRCm39) missense probably benign 0.29
R1140:Ahnak UTSW 19 8,981,609 (GRCm39) missense probably damaging 1.00
R1158:Ahnak UTSW 19 8,991,290 (GRCm39) missense probably benign 0.00
R1218:Ahnak UTSW 19 8,992,983 (GRCm39) missense probably damaging 1.00
R1225:Ahnak UTSW 19 8,980,247 (GRCm39) missense probably damaging 1.00
R1245:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R1421:Ahnak UTSW 19 8,992,995 (GRCm39) missense possibly damaging 0.95
R1447:Ahnak UTSW 19 8,984,446 (GRCm39) missense probably damaging 0.98
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1464:Ahnak UTSW 19 8,982,260 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1466:Ahnak UTSW 19 8,993,239 (GRCm39) missense probably damaging 1.00
R1471:Ahnak UTSW 19 8,990,296 (GRCm39) intron probably benign
R1507:Ahnak UTSW 19 8,987,441 (GRCm39) missense probably damaging 1.00
R1521:Ahnak UTSW 19 8,982,092 (GRCm39) missense probably benign 0.11
R1568:Ahnak UTSW 19 8,979,739 (GRCm39) missense probably damaging 0.98
R1569:Ahnak UTSW 19 8,981,458 (GRCm39) missense possibly damaging 0.78
R1616:Ahnak UTSW 19 8,986,351 (GRCm39) missense possibly damaging 0.94
R1638:Ahnak UTSW 19 8,986,813 (GRCm39) missense probably benign 0.01
R1680:Ahnak UTSW 19 8,987,327 (GRCm39) missense probably benign 0.05
R1713:Ahnak UTSW 19 8,989,173 (GRCm39) missense possibly damaging 0.95
R1722:Ahnak UTSW 19 8,988,019 (GRCm39) missense probably damaging 0.99
R1771:Ahnak UTSW 19 8,991,117 (GRCm39) missense probably benign 0.24
R1795:Ahnak UTSW 19 8,979,802 (GRCm39) missense possibly damaging 0.79
R1823:Ahnak UTSW 19 8,982,269 (GRCm39) missense probably damaging 0.99
R1842:Ahnak UTSW 19 8,983,231 (GRCm39) missense probably damaging 0.99
R1854:Ahnak UTSW 19 8,991,196 (GRCm39) missense possibly damaging 0.61
R1856:Ahnak UTSW 19 8,979,412 (GRCm39) missense possibly damaging 0.86
R1886:Ahnak UTSW 19 8,993,343 (GRCm39) missense probably damaging 0.98
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1888:Ahnak UTSW 19 8,984,452 (GRCm39) missense probably damaging 1.00
R1912:Ahnak UTSW 19 8,995,245 (GRCm39) missense probably damaging 1.00
R1913:Ahnak UTSW 19 8,985,286 (GRCm39) missense probably damaging 0.99
R1942:Ahnak UTSW 19 8,992,447 (GRCm39) missense probably damaging 0.98
R1987:Ahnak UTSW 19 8,992,615 (GRCm39) missense probably damaging 1.00
R2006:Ahnak UTSW 19 8,984,439 (GRCm39) missense probably damaging 1.00
R2013:Ahnak UTSW 19 8,991,937 (GRCm39) missense probably damaging 0.98
R2014:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R2047:Ahnak UTSW 19 8,991,664 (GRCm39) missense possibly damaging 0.67
R2048:Ahnak UTSW 19 8,984,420 (GRCm39) missense probably damaging 0.99
R2060:Ahnak UTSW 19 8,985,405 (GRCm39) missense probably benign 0.08
R2083:Ahnak UTSW 19 8,988,921 (GRCm39) missense probably damaging 1.00
R2157:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R2167:Ahnak UTSW 19 8,988,858 (GRCm39) nonsense probably null
R2208:Ahnak UTSW 19 8,995,096 (GRCm39) missense probably benign 0.00
R2224:Ahnak UTSW 19 8,990,355 (GRCm39) intron probably benign
R2268:Ahnak UTSW 19 8,987,938 (GRCm39) missense possibly damaging 0.66
R2420:Ahnak UTSW 19 8,986,620 (GRCm39) missense possibly damaging 0.89
R2426:Ahnak UTSW 19 8,980,215 (GRCm39) missense possibly damaging 0.81
R2910:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2911:Ahnak UTSW 19 8,989,018 (GRCm39) missense probably damaging 0.99
R2981:Ahnak UTSW 19 8,977,512 (GRCm39) missense probably damaging 0.97
R3151:Ahnak UTSW 19 8,987,308 (GRCm39) missense probably benign 0.12
R3155:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R3422:Ahnak UTSW 19 8,984,116 (GRCm39) missense probably benign 0.05
R3422:Ahnak UTSW 19 8,983,072 (GRCm39) missense probably benign 0.39
R3430:Ahnak UTSW 19 8,984,322 (GRCm39) missense probably benign 0.42
R3433:Ahnak UTSW 19 8,987,358 (GRCm39) missense probably benign 0.01
R3711:Ahnak UTSW 19 8,985,262 (GRCm39) missense probably benign
R3723:Ahnak UTSW 19 8,994,217 (GRCm39) missense possibly damaging 0.79
R3775:Ahnak UTSW 19 8,986,387 (GRCm39) missense possibly damaging 0.91
R3858:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3859:Ahnak UTSW 19 8,988,223 (GRCm39) missense possibly damaging 0.82
R3922:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3924:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R3926:Ahnak UTSW 19 8,983,692 (GRCm39) missense probably benign 0.20
R4026:Ahnak UTSW 19 8,988,663 (GRCm39) missense probably damaging 0.97
R4051:Ahnak UTSW 19 8,991,691 (GRCm39) missense probably damaging 1.00
R4209:Ahnak UTSW 19 8,979,964 (GRCm39) missense probably damaging 1.00
R4234:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R4237:Ahnak UTSW 19 8,979,147 (GRCm39) missense probably benign 0.02
R4285:Ahnak UTSW 19 8,994,203 (GRCm39) nonsense probably null
R4331:Ahnak UTSW 19 8,993,184 (GRCm39) missense probably damaging 1.00
R4342:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R4430:Ahnak UTSW 19 8,980,404 (GRCm39) missense probably benign 0.00
R4554:Ahnak UTSW 19 8,992,294 (GRCm39) missense probably damaging 1.00
R4602:Ahnak UTSW 19 8,988,189 (GRCm39) missense possibly damaging 0.66
R4612:Ahnak UTSW 19 8,981,088 (GRCm39) missense probably benign 0.44
R4655:Ahnak UTSW 19 8,986,065 (GRCm39) missense probably damaging 1.00
R4656:Ahnak UTSW 19 8,982,219 (GRCm39) missense possibly damaging 0.80
R4700:Ahnak UTSW 19 8,982,045 (GRCm39) missense probably benign 0.02
R4704:Ahnak UTSW 19 8,989,622 (GRCm39) intron probably benign
R4704:Ahnak UTSW 19 8,990,545 (GRCm39) missense probably damaging 0.99
R4705:Ahnak UTSW 19 8,994,270 (GRCm39) missense probably benign 0.07
R4707:Ahnak UTSW 19 8,994,099 (GRCm39) missense probably benign 0.03
R4732:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4733:Ahnak UTSW 19 8,984,665 (GRCm39) missense probably damaging 1.00
R4778:Ahnak UTSW 19 8,989,339 (GRCm39) missense possibly damaging 0.79
R4782:Ahnak UTSW 19 8,989,863 (GRCm39) intron probably benign
R4832:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R4882:Ahnak UTSW 19 8,983,261 (GRCm39) missense probably damaging 0.98
R4884:Ahnak UTSW 19 8,990,118 (GRCm39) intron probably benign
R4895:Ahnak UTSW 19 8,994,805 (GRCm39) missense probably benign 0.43
R4930:Ahnak UTSW 19 8,988,331 (GRCm39) missense possibly damaging 0.79
R4951:Ahnak UTSW 19 8,995,199 (GRCm39) missense probably damaging 1.00
R4968:Ahnak UTSW 19 8,992,464 (GRCm39) missense probably damaging 1.00
R5026:Ahnak UTSW 19 8,987,995 (GRCm39) missense possibly damaging 0.46
R5050:Ahnak UTSW 19 8,989,822 (GRCm39) intron probably benign
R5073:Ahnak UTSW 19 8,980,595 (GRCm39) missense probably benign 0.42
R5110:Ahnak UTSW 19 8,992,123 (GRCm39) missense probably damaging 1.00
R5119:Ahnak UTSW 19 8,991,008 (GRCm39) missense probably benign 0.00
R5128:Ahnak UTSW 19 8,994,451 (GRCm39) missense probably damaging 1.00
R5139:Ahnak UTSW 19 8,982,019 (GRCm39) missense probably damaging 1.00
R5150:Ahnak UTSW 19 8,988,268 (GRCm39) missense possibly damaging 0.46
R5151:Ahnak UTSW 19 8,994,933 (GRCm39) missense probably benign 0.03
R5165:Ahnak UTSW 19 8,993,029 (GRCm39) missense possibly damaging 0.95
R5236:Ahnak UTSW 19 8,978,048 (GRCm39) missense possibly damaging 0.92
R5361:Ahnak UTSW 19 8,992,705 (GRCm39) missense possibly damaging 0.92
R5366:Ahnak UTSW 19 8,994,099 (GRCm39) missense possibly damaging 0.65
R5387:Ahnak UTSW 19 8,981,055 (GRCm39) missense probably damaging 1.00
R5396:Ahnak UTSW 19 8,984,539 (GRCm39) missense probably damaging 0.99
R5583:Ahnak UTSW 19 8,984,281 (GRCm39) missense probably damaging 0.99
R5587:Ahnak UTSW 19 8,986,840 (GRCm39) missense possibly damaging 0.88
R5620:Ahnak UTSW 19 8,990,458 (GRCm39) nonsense probably null
R5643:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5644:Ahnak UTSW 19 8,988,021 (GRCm39) missense possibly damaging 0.66
R5657:Ahnak UTSW 19 8,991,979 (GRCm39) missense probably damaging 0.99
R5688:Ahnak UTSW 19 8,979,883 (GRCm39) missense probably benign 0.01
R5702:Ahnak UTSW 19 8,979,204 (GRCm39) missense probably damaging 1.00
R5727:Ahnak UTSW 19 8,994,111 (GRCm39) missense probably damaging 0.99
R5730:Ahnak UTSW 19 8,987,617 (GRCm39) missense possibly damaging 0.81
R5755:Ahnak UTSW 19 8,979,096 (GRCm39) missense probably benign 0.06
R5760:Ahnak UTSW 19 8,990,926 (GRCm39) missense probably damaging 1.00
R5789:Ahnak UTSW 19 8,979,685 (GRCm39) missense probably benign 0.00
R5790:Ahnak UTSW 19 8,992,612 (GRCm39) missense probably damaging 0.99
R5795:Ahnak UTSW 19 8,989,746 (GRCm39) nonsense probably null
R5808:Ahnak UTSW 19 8,987,599 (GRCm39) missense possibly damaging 0.91
R5867:Ahnak UTSW 19 8,987,416 (GRCm39) missense probably damaging 0.99
R5878:Ahnak UTSW 19 8,985,706 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,995,575 (GRCm39) missense probably damaging 1.00
R5898:Ahnak UTSW 19 8,991,131 (GRCm39) missense possibly damaging 0.63
R5912:Ahnak UTSW 19 8,989,267 (GRCm39) missense probably damaging 0.99
R5935:Ahnak UTSW 19 8,992,546 (GRCm39) missense possibly damaging 0.91
R5969:Ahnak UTSW 19 8,993,949 (GRCm39) missense probably damaging 1.00
R5988:Ahnak UTSW 19 8,986,711 (GRCm39) intron probably benign
R6000:Ahnak UTSW 19 8,990,475 (GRCm39) nonsense probably null
R6005:Ahnak UTSW 19 8,992,525 (GRCm39) missense possibly damaging 0.61
R6101:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6105:Ahnak UTSW 19 8,981,463 (GRCm39) missense probably benign 0.20
R6116:Ahnak UTSW 19 8,990,327 (GRCm39) intron probably benign
R6209:Ahnak UTSW 19 8,989,930 (GRCm39) missense probably damaging 1.00
R6240:Ahnak UTSW 19 8,990,947 (GRCm39) missense probably damaging 1.00
R6255:Ahnak UTSW 19 8,985,389 (GRCm39) missense possibly damaging 0.95
R6263:Ahnak UTSW 19 8,995,641 (GRCm39) missense probably benign 0.03
R6287:Ahnak UTSW 19 8,992,367 (GRCm39) missense probably benign 0.02
R6296:Ahnak UTSW 19 8,980,669 (GRCm39) missense probably damaging 0.99
R6315:Ahnak UTSW 19 8,983,990 (GRCm39) missense probably damaging 0.99
R6328:Ahnak UTSW 19 8,984,512 (GRCm39) missense probably benign 0.11
R6331:Ahnak UTSW 19 8,983,989 (GRCm39) missense probably benign 0.18
R6355:Ahnak UTSW 19 8,986,126 (GRCm39) missense probably benign 0.02
R6409:Ahnak UTSW 19 8,986,938 (GRCm39) missense probably benign 0.31
R6567:Ahnak UTSW 19 8,986,170 (GRCm39) missense probably benign 0.27
R6572:Ahnak UTSW 19 8,985,340 (GRCm39) missense probably damaging 0.99
R6574:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R6590:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6620:Ahnak UTSW 19 8,992,674 (GRCm39) missense possibly damaging 0.95
R6690:Ahnak UTSW 19 8,986,945 (GRCm39) missense probably benign 0.29
R6731:Ahnak UTSW 19 8,988,926 (GRCm39) missense possibly damaging 0.85
R6756:Ahnak UTSW 19 8,984,925 (GRCm39) missense possibly damaging 0.59
R6846:Ahnak UTSW 19 8,989,221 (GRCm39) missense possibly damaging 0.66
R6854:Ahnak UTSW 19 8,992,599 (GRCm39) missense probably damaging 1.00
R6857:Ahnak UTSW 19 9,014,532 (GRCm39) nonsense probably null
R6863:Ahnak UTSW 19 8,989,729 (GRCm39) intron probably benign
R6876:Ahnak UTSW 19 8,991,484 (GRCm39) missense probably damaging 0.99
R6958:Ahnak UTSW 19 8,992,579 (GRCm39) missense possibly damaging 0.88
R7126:Ahnak UTSW 19 8,979,723 (GRCm39) missense possibly damaging 0.61
R7181:Ahnak UTSW 19 8,990,852 (GRCm39) missense probably damaging 1.00
R7183:Ahnak UTSW 19 8,995,032 (GRCm39) missense probably damaging 1.00
R7202:Ahnak UTSW 19 8,995,163 (GRCm39) missense probably damaging 1.00
R7235:Ahnak UTSW 19 8,989,852 (GRCm39) missense unknown
R7241:Ahnak UTSW 19 8,986,395 (GRCm39) missense possibly damaging 0.65
R7269:Ahnak UTSW 19 8,983,981 (GRCm39) missense probably damaging 1.00
R7311:Ahnak UTSW 19 8,979,507 (GRCm39) missense probably benign 0.04
R7311:Ahnak UTSW 19 8,987,191 (GRCm39) missense possibly damaging 0.56
R7329:Ahnak UTSW 19 8,979,156 (GRCm39) missense probably damaging 0.99
R7339:Ahnak UTSW 19 8,985,529 (GRCm39) missense possibly damaging 0.75
R7390:Ahnak UTSW 19 8,980,569 (GRCm39) missense probably benign 0.02
R7400:Ahnak UTSW 19 8,991,977 (GRCm39) missense probably damaging 0.99
R7444:Ahnak UTSW 19 8,984,787 (GRCm39) missense probably benign 0.08
R7483:Ahnak UTSW 19 8,982,186 (GRCm39) missense probably damaging 1.00
R7498:Ahnak UTSW 19 8,989,383 (GRCm39) missense probably benign 0.14
R7521:Ahnak UTSW 19 8,979,715 (GRCm39) missense possibly damaging 0.89
R7522:Ahnak UTSW 19 8,979,686 (GRCm39) missense probably benign 0.01
R7552:Ahnak UTSW 19 8,984,188 (GRCm39) missense probably benign 0.18
R7563:Ahnak UTSW 19 8,988,529 (GRCm39) missense probably damaging 0.99
R7565:Ahnak UTSW 19 8,993,520 (GRCm39) missense probably benign 0.05
R7571:Ahnak UTSW 19 8,978,150 (GRCm39) nonsense probably null
R7583:Ahnak UTSW 19 8,983,457 (GRCm39) missense possibly damaging 0.90
R7600:Ahnak UTSW 19 8,981,938 (GRCm39) missense possibly damaging 0.89
R7787:Ahnak UTSW 19 8,986,679 (GRCm39) missense unknown
R7827:Ahnak UTSW 19 8,982,708 (GRCm39) nonsense probably null
R7857:Ahnak UTSW 19 8,984,832 (GRCm39) missense probably damaging 0.97
R7916:Ahnak UTSW 19 8,983,196 (GRCm39) missense possibly damaging 0.66
R7939:Ahnak UTSW 19 8,991,448 (GRCm39) nonsense probably null
R7959:Ahnak UTSW 19 8,988,013 (GRCm39) missense possibly damaging 0.46
R7962:Ahnak UTSW 19 8,990,164 (GRCm39) missense unknown
R7979:Ahnak UTSW 19 8,988,796 (GRCm39) missense probably damaging 1.00
R8006:Ahnak UTSW 19 8,989,447 (GRCm39) missense possibly damaging 0.79
R8013:Ahnak UTSW 19 8,986,699 (GRCm39) missense unknown
R8033:Ahnak UTSW 19 8,981,074 (GRCm39) missense probably benign 0.10
R8124:Ahnak UTSW 19 8,984,487 (GRCm39) missense probably damaging 0.99
R8125:Ahnak UTSW 19 8,989,240 (GRCm39) missense possibly damaging 0.95
R8129:Ahnak UTSW 19 8,977,464 (GRCm39) start codon destroyed not run
R8151:Ahnak UTSW 19 8,982,043 (GRCm39) missense possibly damaging 0.59
R8190:Ahnak UTSW 19 8,979,619 (GRCm39) missense probably benign 0.01
R8221:Ahnak UTSW 19 8,987,800 (GRCm39) nonsense probably null
R8241:Ahnak UTSW 19 8,984,659 (GRCm39) missense probably benign 0.15
R8244:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8248:Ahnak UTSW 19 8,979,310 (GRCm39) missense probably damaging 1.00
R8261:Ahnak UTSW 19 8,982,817 (GRCm39) missense probably damaging 1.00
R8330:Ahnak UTSW 19 8,987,026 (GRCm39) missense possibly damaging 0.86
R8380:Ahnak UTSW 19 8,995,219 (GRCm39) missense probably benign 0.05
R8407:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8409:Ahnak UTSW 19 8,993,037 (GRCm39) missense probably benign 0.44
R8463:Ahnak UTSW 19 8,986,113 (GRCm39) missense probably benign 0.07
R8511:Ahnak UTSW 19 8,989,719 (GRCm39) missense unknown
R8528:Ahnak UTSW 19 8,985,092 (GRCm39) missense probably damaging 1.00
R8549:Ahnak UTSW 19 8,988,847 (GRCm39) missense probably damaging 1.00
R8674:Ahnak UTSW 19 8,983,360 (GRCm39) missense probably damaging 0.98
R8716:Ahnak UTSW 19 8,986,438 (GRCm39) missense probably damaging 1.00
R8722:Ahnak UTSW 19 8,990,710 (GRCm39) nonsense probably null
R8751:Ahnak UTSW 19 8,987,509 (GRCm39) missense probably damaging 1.00
R8752:Ahnak UTSW 19 8,992,901 (GRCm39) missense probably damaging 1.00
R8783:Ahnak UTSW 19 8,988,837 (GRCm39) missense probably damaging 1.00
R8844:Ahnak UTSW 19 8,984,254 (GRCm39) missense probably damaging 1.00
R8859:Ahnak UTSW 19 8,984,567 (GRCm39) missense probably damaging 1.00
R8882:Ahnak UTSW 19 8,978,106 (GRCm39) missense probably damaging 1.00
R8907:Ahnak UTSW 19 8,986,452 (GRCm39) missense probably benign 0.24
R8938:Ahnak UTSW 19 8,989,099 (GRCm39) missense probably benign 0.00
R8975:Ahnak UTSW 19 8,990,101 (GRCm39) missense probably damaging 1.00
R8983:Ahnak UTSW 19 8,981,477 (GRCm39) missense possibly damaging 0.75
R9017:Ahnak UTSW 19 8,987,487 (GRCm39) missense probably damaging 1.00
R9027:Ahnak UTSW 19 8,984,617 (GRCm39) missense possibly damaging 0.94
R9081:Ahnak UTSW 19 8,985,890 (GRCm39) missense possibly damaging 0.81
R9104:Ahnak UTSW 19 8,987,711 (GRCm39) missense probably benign 0.01
R9112:Ahnak UTSW 19 8,987,149 (GRCm39) missense probably damaging 0.98
R9145:Ahnak UTSW 19 8,992,287 (GRCm39) missense probably benign 0.38
R9189:Ahnak UTSW 19 8,988,247 (GRCm39) missense possibly damaging 0.92
R9221:Ahnak UTSW 19 8,989,943 (GRCm39) missense probably damaging 1.00
R9261:Ahnak UTSW 19 8,993,503 (GRCm39) missense possibly damaging 0.63
R9299:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9325:Ahnak UTSW 19 8,991,257 (GRCm39) missense probably benign 0.12
R9337:Ahnak UTSW 19 8,989,824 (GRCm39) intron probably benign
R9340:Ahnak UTSW 19 8,994,411 (GRCm39) missense probably benign 0.04
R9351:Ahnak UTSW 19 8,985,232 (GRCm39) missense probably damaging 1.00
R9416:Ahnak UTSW 19 8,990,266 (GRCm39) missense unknown
R9462:Ahnak UTSW 19 8,981,299 (GRCm39) missense probably damaging 0.96
R9469:Ahnak UTSW 19 8,988,225 (GRCm39) missense probably damaging 1.00
R9485:Ahnak UTSW 19 8,979,438 (GRCm39) missense probably benign 0.16
R9503:Ahnak UTSW 19 8,987,458 (GRCm39) missense probably damaging 1.00
R9524:Ahnak UTSW 19 9,014,617 (GRCm39) missense
R9534:Ahnak UTSW 19 8,980,976 (GRCm39) missense probably benign 0.20
R9598:Ahnak UTSW 19 8,981,149 (GRCm39) missense probably benign 0.42
R9611:Ahnak UTSW 19 8,989,162 (GRCm39) missense probably damaging 0.99
R9624:Ahnak UTSW 19 8,989,846 (GRCm39) missense unknown
R9649:Ahnak UTSW 19 8,985,786 (GRCm39) nonsense probably null
R9683:Ahnak UTSW 19 8,984,719 (GRCm39) missense possibly damaging 0.94
R9691:Ahnak UTSW 19 8,989,090 (GRCm39) missense possibly damaging 0.49
R9712:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9712:Ahnak UTSW 19 8,984,392 (GRCm39) small deletion probably benign
R9713:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9715:Ahnak UTSW 19 8,984,393 (GRCm39) small deletion probably benign
R9725:Ahnak UTSW 19 8,991,607 (GRCm39) missense probably damaging 1.00
R9725:Ahnak UTSW 19 8,981,533 (GRCm39) missense probably benign 0.44
R9747:Ahnak UTSW 19 8,987,541 (GRCm39) missense possibly damaging 0.49
R9798:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
RF007:Ahnak UTSW 19 8,990,965 (GRCm39) missense possibly damaging 0.45
X0021:Ahnak UTSW 19 8,990,983 (GRCm39) missense probably damaging 0.99
X0027:Ahnak UTSW 19 8,989,401 (GRCm39) missense probably damaging 1.00
Z1088:Ahnak UTSW 19 8,993,446 (GRCm39) missense probably damaging 0.99
Z1176:Ahnak UTSW 19 8,986,220 (GRCm39) missense probably damaging 0.97
Z1177:Ahnak UTSW 19 8,994,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACATCAAGGCTCCCAAG -3'
(R):5'- TGGGAGCCTTGATGTTAATCTC -3'

Sequencing Primer
(F):5'- CAAGATCTCCATGCCTGATATTGAC -3'
(R):5'- CCTTGATGTTAATCTCAGGCATC -3'
Posted On 2019-11-26