Incidental Mutation 'R7772:Crnkl1'
ID598622
Institutional Source Beutler Lab
Gene Symbol Crnkl1
Ensembl Gene ENSMUSG00000001767
Gene Namecrooked neck pre-mRNA splicing factor 1
Synonyms5730590A01Rik, crn, 1200013P10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7772 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location145917479-145935014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145930644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 171 (V171A)
Ref Sequence ENSEMBL: ENSMUSP00000001818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001818] [ENSMUST00000116398] [ENSMUST00000118002] [ENSMUST00000126415] [ENSMUST00000130168] [ENSMUST00000133433] [ENSMUST00000138774] [ENSMUST00000152515]
Predicted Effect probably benign
Transcript: ENSMUST00000001818
AA Change: V171A

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000001818
Gene: ENSMUSG00000001767
AA Change: V171A

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 30 52 N/A INTRINSIC
HAT 61 93 4.57e-2 SMART
HAT 95 127 3.48e-7 SMART
HAT 129 161 3.33e-4 SMART
HAT 163 194 2.48e-3 SMART
HAT 196 227 1.32e-7 SMART
HAT 229 264 2.11e-6 SMART
HAT 266 300 2.07e0 SMART
Blast:HAT 310 342 1e-13 BLAST
HAT 344 378 3.88e-5 SMART
HAT 388 424 6.86e-6 SMART
HAT 426 457 1.92e2 SMART
HAT 459 491 1.29e-1 SMART
HAT 493 527 2e-7 SMART
HAT 529 560 8.07e-3 SMART
coiled coil region 566 596 N/A INTRINSIC
low complexity region 655 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116398
SMART Domains Protein: ENSMUSP00000112099
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 237 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118002
SMART Domains Protein: ENSMUSP00000113529
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126415
SMART Domains Protein: ENSMUSP00000118626
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 244 1e-5 SMART
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130168
SMART Domains Protein: ENSMUSP00000121294
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133433
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138774
SMART Domains Protein: ENSMUSP00000120838
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
SCOP:d1b87a_ 99 153 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152515
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The crooked neck (crn) gene of Drosophila is essential for embryogenesis and is thought to be involved in cell cycle progression and pre-mRNA splicing. A protein encoded by this human locus has been found to localize to pre-mRNA splicing complexes in the nucleus and is necessary for pre-mRNA splicing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Other mutations in Crnkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Crnkl1 APN 2 145918468 missense possibly damaging 0.75
IGL01092:Crnkl1 APN 2 145919948 missense probably benign 0.00
IGL01643:Crnkl1 APN 2 145931348 missense probably damaging 0.99
IGL01902:Crnkl1 APN 2 145924712 splice site probably null
IGL01908:Crnkl1 APN 2 145928155 missense probably benign 0.01
IGL01934:Crnkl1 APN 2 145931282 missense probably benign 0.02
IGL01947:Crnkl1 APN 2 145921824 missense probably benign 0.05
IGL02342:Crnkl1 APN 2 145924713 critical splice donor site probably null
IGL02721:Crnkl1 APN 2 145923881 missense possibly damaging 0.90
IGL02794:Crnkl1 APN 2 145930612 missense possibly damaging 0.55
IGL02877:Crnkl1 APN 2 145920671 nonsense probably null
IGL03131:Crnkl1 APN 2 145932258 missense probably benign 0.02
R0326:Crnkl1 UTSW 2 145919955 missense probably benign
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1462:Crnkl1 UTSW 2 145921819 missense probably damaging 0.97
R1471:Crnkl1 UTSW 2 145932316 missense possibly damaging 0.69
R1951:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1952:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R1953:Crnkl1 UTSW 2 145928200 missense probably damaging 0.98
R2112:Crnkl1 UTSW 2 145930697 nonsense probably null
R2405:Crnkl1 UTSW 2 145928157 nonsense probably null
R2972:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2973:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R2974:Crnkl1 UTSW 2 145932261 missense probably benign 0.07
R3801:Crnkl1 UTSW 2 145919795 missense probably benign
R3811:Crnkl1 UTSW 2 145931306 missense probably damaging 1.00
R4037:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4038:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4039:Crnkl1 UTSW 2 145932327 missense possibly damaging 0.82
R4976:Crnkl1 UTSW 2 145923876 missense possibly damaging 0.86
R5396:Crnkl1 UTSW 2 145928212 missense possibly damaging 0.74
R5868:Crnkl1 UTSW 2 145918553 missense probably benign 0.11
R6245:Crnkl1 UTSW 2 145928131 missense probably benign 0.03
R6564:Crnkl1 UTSW 2 145928245 missense possibly damaging 0.67
R7787:Crnkl1 UTSW 2 145925595 missense probably benign 0.05
R7829:Crnkl1 UTSW 2 145931349 missense probably benign 0.20
R8022:Crnkl1 UTSW 2 145918566 missense probably damaging 0.99
R8045:Crnkl1 UTSW 2 145932931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGACGAAACTTGCCTTC -3'
(R):5'- ATGAAGCCTTCCTCCCCTATGG -3'

Sequencing Primer
(F):5'- GTAGCTACATGTCTTTACTGTGAC -3'
(R):5'- CCTCCTGAGTCATTTTGACC -3'
Posted On2019-11-26