Mutagenetix > Incidental Mutations

Incidental Mutation 'R7772:Nup210l'

598624

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R7772 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 90159926 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 758 (S758G)

Ref Sequence

ENSEMBL: ENSMUSP00000029548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029548
AA Change: S758G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: S758G

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200410
AA Change: S758G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: S758G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adora3	T	C	3: 105,907,723	V263A	probably benign	Het
Adprhl1	C	T	8: 13,248,682	V83I	probably damaging	Het
Arfgef1	A	G	1: 10,157,010	V1368A	possibly damaging	Het
Arid4a	A	T	12: 71,061,589	N56I	possibly damaging	Het
Art3	A	T	5: 92,403,613	Y277F	probably damaging	Het
Atp2a1	A	T	7: 126,448,535		probably null	Het
Banf1	T	C	19: 5,365,122	K54E	possibly damaging	Het
Bckdk	A	G	7: 127,905,901	Y151C	probably damaging	Het
C1qtnf3	C	A	15: 10,958,044	P58T	possibly damaging	Het
Cadps2	T	C	6: 23,390,446	R744G	probably benign	Het
Cdc25b	A	G	2: 131,189,109	D118G	probably damaging	Het
Cnot9	G	A	1: 74,526,992	V181I	probably damaging	Het
Cobl	C	T	11: 12,254,488	G738D	probably benign	Het
Crnkl1	A	G	2: 145,930,644	V171A	probably benign	Het
Dhx57	C	T	17: 80,273,078	D482N	possibly damaging	Het
Drd3	G	T	16: 43,762,395	A52S	probably benign	Het
Dst	T	C	1: 34,181,388	V2091A	possibly damaging	Het
Evpl	T	C	11: 116,221,435	T1810A	probably benign	Het
Fbxo2	T	A	4: 148,164,326	W92R	probably damaging	Het
Gas2l2	T	A	11: 83,429,277	D51V	possibly damaging	Het
Gm11232	A	T	4: 71,756,581	V228E	possibly damaging	Het
Gm14305	C	T	2: 176,720,971	Q219*	probably null	Het
Gpr137b	T	C	13: 13,359,406	Y355C	probably damaging	Het
Gpr39	G	T	1: 125,677,597	M87I	possibly damaging	Het
Heatr1	T	C	13: 12,417,641	M1089T	probably benign	Het
Ifi206	A	T	1: 173,481,074	M452K		Het
Ints8	A	T	4: 11,227,190	I561N	probably damaging	Het
Itgb2	A	T	10: 77,561,112	K660N	probably benign	Het
Jun	A	C	4: 95,050,844	V143G	probably benign	Het
Kalrn	A	G	16: 34,031,582	M2076T	probably benign	Het
Krt10	G	T	11: 99,389,087	S82R	unknown	Het
Lipm	T	A	19: 34,117,891	H295Q	probably damaging	Het
Mybpc2	A	C	7: 44,515,924		probably null	Het
Nedd4	T	C	9: 72,677,326	V103A	possibly damaging	Het
Nol10	T	C	12: 17,348,585	I11T	probably damaging	Het
Olfr270	T	A	4: 52,970,713	C31S	probably damaging	Het
Olfr584	T	G	7: 103,086,181	I216S	probably benign	Het
Olfr985	T	C	9: 40,127,365	I199V	probably benign	Het
Osbpl9	T	C	4: 109,066,187	H425R	probably damaging	Het
Parp1	G	T	1: 180,589,398	R582S	possibly damaging	Het
Piwil1	A	T	5: 128,739,463	R36S	probably benign	Het
Pjvk	T	C	2: 76,657,533		probably null	Het
Plekha6	G	T	1: 133,170,022	E31D	possibly damaging	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Prm3	CTCTTCTTCTTCTTC	CTCTTCTTCTTC	16: 10,790,701		probably benign	Het
Psmc6	T	A	14: 45,343,650	I301N	probably damaging	Het
Rfpl4	C	A	7: 5,115,544	S9I	probably benign	Het
Rnf14	G	T	18: 38,309,576	C310F	probably damaging	Het
Rnf17	T	A	14: 56,477,687	F845L	probably benign	Het
Robo2	T	C	16: 73,961,889	I665V	probably benign	Het
Rtl1	T	A	12: 109,593,185	H740L	probably damaging	Het
Ryr2	A	G	13: 11,751,011	S1280P	probably benign	Het
Slc12a8	G	A	16: 33,550,965	R126H	probably damaging	Het
Slc9a1	T	C	4: 133,411,965	F165L	probably damaging	Het
Snx19	T	C	9: 30,428,925	I453T	probably damaging	Het
Spag17	T	C	3: 100,080,118	Y1575H	probably damaging	Het
Spef2	T	C	15: 9,704,481	I415M	probably damaging	Het
Ssx2ip	T	G	3: 146,433,130	I459S	probably damaging	Het
Tmem156	A	T	5: 65,080,174	S48T	probably damaging	Het
Unc93a	A	T	17: 13,109,752	F405I	possibly damaging	Het
Vmn1r209	T	A	13: 22,806,494	I9F	possibly damaging	Het
Vmn2r93	A	G	17: 18,313,220	D462G	probably damaging	Het
Wdr90	T	A	17: 25,861,491		probably benign	Het
Zfp551	T	C	7: 12,418,608	D66G	probably damaging	Het
Znrf4	A	C	17: 56,512,247	V20G	possibly damaging	Het
Zscan4d	T	C	7: 11,162,843	E200G	probably benign	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	intron	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R7923:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7930:Nup210l	UTSW	3	90151123	missense	probably benign
R7931:Nup210l	UTSW	3	90203905	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGATCATTCAGTGTGCATTGGG -3'
(R):5'- TCTGCCCTTGTGGATCGATATC -3'

Sequencing Primer
(F):5'- ATCATATCCAGAAGGGCTCCTTTGG -3'
(R):5'- CCCTTGTGGATCGATATCAGCAGAG -3'

Posted On

2019-11-26