Incidental Mutation 'R7772:Osbpl9'
ID598632
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Nameoxysterol binding protein-like 9
SynonymsORP-9, 2600011I06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7772 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location109061145-109202272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109066187 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 425 (H425R)
Ref Sequence ENSEMBL: ENSMUSP00000081396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000065977] [ENSMUST00000084366] [ENSMUST00000102736] [ENSMUST00000159545] [ENSMUST00000160271] [ENSMUST00000160774] [ENSMUST00000161363] [ENSMUST00000162787] [ENSMUST00000194478]
Predicted Effect probably damaging
Transcript: ENSMUST00000030288
AA Change: H522R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: H522R

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065977
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084366
AA Change: H425R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081396
Gene: ENSMUSG00000028559
AA Change: H425R

DomainStartEndE-ValueType
low complexity region 156 177 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 252 265 N/A INTRINSIC
Pfam:Oxysterol_BP 277 634 7.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102736
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000160271
AA Change: H412R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124112
Gene: ENSMUSG00000028559
AA Change: H412R

DomainStartEndE-ValueType
low complexity region 143 164 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
Pfam:Oxysterol_BP 264 621 4.7e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160774
AA Change: H505R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: H505R

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161363
AA Change: H442R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559
AA Change: H442R

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162787
AA Change: H509R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559
AA Change: H509R

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194478
AA Change: H532R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559
AA Change: H532R

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 109072010 missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 109087431 missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 109133763 missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 109071979 missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 109068483 nonsense probably null
IGL02822:Osbpl9 APN 4 109072921 missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 109071961 missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 109066966 missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 109072864 missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109172332 splice site probably benign
IGL03323:Osbpl9 APN 4 109062459 splice site probably benign
Oblong UTSW 4 109091679 missense possibly damaging 0.62
R0211:Osbpl9 UTSW 4 109073124 missense probably damaging 1.00
R0368:Osbpl9 UTSW 4 109066932 missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 109083128 missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 109101156 missense probably damaging 1.00
R1711:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 109064583 missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109156657 missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109202134 missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 109083093 missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109172240 intron probably benign
R4672:Osbpl9 UTSW 4 109064609 missense possibly damaging 0.82
R4706:Osbpl9 UTSW 4 109156687 missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R4886:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R5035:Osbpl9 UTSW 4 109066167 missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 109066155 missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 109062300 nonsense probably null
R5719:Osbpl9 UTSW 4 109062566 nonsense probably null
R5810:Osbpl9 UTSW 4 109086374 missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109156702 missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 109072932 missense possibly damaging 0.89
R6648:Osbpl9 UTSW 4 109091679 missense possibly damaging 0.62
R6675:Osbpl9 UTSW 4 109133828 splice site probably null
R7130:Osbpl9 UTSW 4 109083099 missense probably benign
R7356:Osbpl9 UTSW 4 109068480 nonsense probably null
R7615:Osbpl9 UTSW 4 109086339 missense probably damaging 1.00
R7753:Osbpl9 UTSW 4 109133773 missense possibly damaging 0.86
R7788:Osbpl9 UTSW 4 109062494 missense probably benign 0.41
Z1177:Osbpl9 UTSW 4 109107880 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATATAGTTTATACCCCACCCAGTCC -3'
(R):5'- ACGTCTTAAACCTGCGGGAG -3'

Sequencing Primer
(F):5'- CCCCTCCAAATCCCTAAGTCTACATG -3'
(R):5'- TTAAACCTGCGGGAGTTGCC -3'
Posted On2019-11-26