Incidental Mutation 'R7772:Tmem156'
ID598635
Institutional Source Beutler Lab
Gene Symbol Tmem156
Ensembl Gene ENSMUSG00000037913
Gene Nametransmembrane protein 156
SynonymsLOC243025
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R7772 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location65054346-65092132 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65080174 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 48 (S48T)
Ref Sequence ENSEMBL: ENSMUSP00000148480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043352] [ENSMUST00000212080] [ENSMUST00000212194] [ENSMUST00000212640]
Predicted Effect probably damaging
Transcript: ENSMUST00000043352
AA Change: S36T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044102
Gene: ENSMUSG00000037913
AA Change: S36T

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:TMEM156 39 264 1.2e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212080
AA Change: S48T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000212194
Predicted Effect probably benign
Transcript: ENSMUST00000212640
Meta Mutation Damage Score 0.3746 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,889,784 probably null Het
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Col18a1 T A 10: 77,068,386 probably null Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Dpysl2 A T 14: 66,828,976 probably null Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Stfa1 A G 16: 36,277,001 probably null Het
Tmx3 T A 18: 90,527,794 probably null Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Zufsp A T 10: 33,921,702 probably null Het
Other mutations in Tmem156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Tmem156 APN 5 65073840 missense probably damaging 1.00
IGL01064:Tmem156 APN 5 65079984 missense probably damaging 0.99
IGL01330:Tmem156 APN 5 65080182 missense probably benign 0.17
IGL03336:Tmem156 APN 5 65075764 missense probably benign 0.01
IGL03383:Tmem156 APN 5 65075697 missense probably damaging 0.98
R0526:Tmem156 UTSW 5 65075818 missense probably benign 0.02
R2006:Tmem156 UTSW 5 65079951 missense probably damaging 1.00
R4721:Tmem156 UTSW 5 65091527 missense probably benign 0.10
R4773:Tmem156 UTSW 5 65080159 missense probably damaging 1.00
R4810:Tmem156 UTSW 5 65091447 intron probably benign
R4910:Tmem156 UTSW 5 65091462 intron probably benign
R5148:Tmem156 UTSW 5 65073768 missense probably benign 0.00
R5510:Tmem156 UTSW 5 65075574 missense probably benign 0.02
R5809:Tmem156 UTSW 5 65075607 missense possibly damaging 0.55
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R7731:Tmem156 UTSW 5 65075562 critical splice donor site probably null
R7788:Tmem156 UTSW 5 65075569 missense possibly damaging 0.47
R7979:Tmem156 UTSW 5 65080009 missense possibly damaging 0.47
R8017:Tmem156 UTSW 5 65073861 missense probably damaging 1.00
R8132:Tmem156 UTSW 5 65075755 missense probably benign 0.00
R8249:Tmem156 UTSW 5 65075626 nonsense probably null
RF020:Tmem156 UTSW 5 65091547 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATCTACTTGTGATGCCTCGG -3'
(R):5'- GTTCTCTGAAAACTAACACGGAATG -3'

Sequencing Primer
(F):5'- TCGGCAAATCTCAGCGAAG -3'
(R):5'- TCAAGGACTAGCCATCCT -3'
Posted On2019-11-26