Incidental Mutation 'R7772:Cadps2'
ID598638
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene NameCa2+-dependent activator protein for secretion 2
SynonymsCaps2, cpd2, A230044C21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7772 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location23262773-23839421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23390446 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 744 (R744G)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: R744G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: R744G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: R747G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: R747G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: R744G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: R744G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
AA Change: R744G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: R744G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125350
AA Change: R389G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: R389G

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: R715G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: R715G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: R744G

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: R744G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: R715G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: R715G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R7953:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTAACTGAGTAGTGGCAAG -3'
(R):5'- GTAAATGGCTGCAAACACTTCC -3'

Sequencing Primer
(F):5'- CTGAGTAGTGGCAAGAAGATTTAAC -3'
(R):5'- GCAAACACTTCCATTAAATTTCCGG -3'
Posted On2019-11-26