Incidental Mutation 'R7772:Itgb2'
ID598650
Institutional Source Beutler Lab
Gene Symbol Itgb2
Ensembl Gene ENSMUSG00000000290
Gene Nameintegrin beta 2
SynonymsMac-1 beta, Cd18, 2E6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R7772 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77530252-77565708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77561112 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 660 (K660N)
Ref Sequence ENSEMBL: ENSMUSP00000000299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000153541] [ENSMUST00000156644]
Predicted Effect probably benign
Transcript: ENSMUST00000000299
AA Change: K660N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290
AA Change: K660N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153541
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156644
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T A 11: 3,889,784 probably null Het
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Col18a1 T A 10: 77,068,386 probably null Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Dpysl2 A T 14: 66,828,976 probably null Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Stfa1 A G 16: 36,277,001 probably null Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Tmx3 T A 18: 90,527,794 probably null Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Zufsp A T 10: 33,921,702 probably null Het
Other mutations in Itgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
barely UTSW 10 77548536 splice site probably benign
fresh UTSW 10 77556161 missense probably damaging 0.98
joker UTSW 10 77549849 intron probably benign
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
Only_just UTSW 10 77549968 missense possibly damaging 0.80
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4600:Itgb2 UTSW 10 77546115 missense probably benign
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 critical splice donor site probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
R7305:Itgb2 UTSW 10 77548564 missense probably damaging 1.00
R7574:Itgb2 UTSW 10 77560158 missense probably benign 0.18
R7606:Itgb2 UTSW 10 77556161 missense probably damaging 0.98
R7888:Itgb2 UTSW 10 77564644 missense probably benign 0.00
Z1176:Itgb2 UTSW 10 77557962 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCGCCAATTCACACCTCATG -3'
(R):5'- AGAGATGTTTTCCTCTACAGCCC -3'

Sequencing Primer
(F):5'- ATGCCCTTACATGCTCTCAACAC -3'
(R):5'- ACGGTCAGAGTACTCCACTGAG -3'
Posted On2019-11-26