Incidental Mutation 'R7772:Spef2'
ID598664
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R7772 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9704481 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 415 (I415M)
Ref Sequence ENSEMBL: ENSMUSP00000035762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]
Predicted Effect probably damaging
Transcript: ENSMUST00000041840
AA Change: I415M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: I415M

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159093
AA Change: I472M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: I472M

DomainStartEndE-ValueType
Pfam:DUF1042 5 166 3.5e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159368
AA Change: I415M

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: I415M

DomainStartEndE-ValueType
Pfam:DUF1042 5 162 1.4e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160236
AA Change: I415M

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: I415M

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162780
AA Change: I472M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: I472M

DomainStartEndE-ValueType
Pfam:DUF1042 5 164 1.1e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: I415M

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7263:Spef2 UTSW 15 9653012 synonymous probably null
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7838:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9717563 missense probably damaging 1.00
R7921:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7937:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7938:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7972:Spef2 UTSW 15 9717563 missense probably damaging 1.00
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACATGAATTAACCCAGGAGAG -3'
(R):5'- AGTCAAATTAAGGGCAGTCACC -3'

Sequencing Primer
(F):5'- TTAACCCAGGAGAGAGTGTAAATG -3'
(R):5'- AGGGCAGTCACCTATATAAATATAGC -3'
Posted On2019-11-26