Incidental Mutation 'R7772:Vmn2r93'
ID598672
Institutional Source Beutler Lab
Gene Symbol Vmn2r93
Ensembl Gene ENSMUSG00000079698
Gene Namevomeronasal 2, receptor 93
SynonymsEG627132
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7772 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18298099-18331914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18313220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 462 (D462G)
Ref Sequence ENSEMBL: ENSMUSP00000078200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079206] [ENSMUST00000231879] [ENSMUST00000231938]
Predicted Effect probably damaging
Transcript: ENSMUST00000079206
AA Change: D462G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078200
Gene: ENSMUSG00000079698
AA Change: D462G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 453 5.9e-40 PFAM
Pfam:NCD3G 509 562 2.6e-21 PFAM
Pfam:7tm_3 594 830 1.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231879
AA Change: D462G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000231938
AA Change: D462G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Wdr90 T A 17: 25,861,491 probably benign Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Other mutations in Vmn2r93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Vmn2r93 APN 17 18326242 missense probably damaging 1.00
IGL01326:Vmn2r93 APN 17 18316644 missense possibly damaging 0.92
IGL01328:Vmn2r93 APN 17 18325557 missense probably benign 0.00
IGL01360:Vmn2r93 APN 17 18305248 missense possibly damaging 0.71
IGL01382:Vmn2r93 APN 17 18313316 nonsense probably null
IGL01463:Vmn2r93 APN 17 18304888 missense probably damaging 1.00
IGL02057:Vmn2r93 APN 17 18325770 missense probably damaging 1.00
IGL02257:Vmn2r93 APN 17 18325508 unclassified probably benign
IGL02686:Vmn2r93 APN 17 18313264 missense possibly damaging 0.89
IGL02720:Vmn2r93 APN 17 18305034 missense probably damaging 1.00
IGL03328:Vmn2r93 APN 17 18304958 missense probably damaging 1.00
PIT4576001:Vmn2r93 UTSW 17 18313211 missense probably benign
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0067:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0240:Vmn2r93 UTSW 17 18304799 missense probably benign 0.00
R0488:Vmn2r93 UTSW 17 18326049 missense probably damaging 1.00
R0667:Vmn2r93 UTSW 17 18326241 missense probably damaging 1.00
R0668:Vmn2r93 UTSW 17 18298405 missense probably benign 0.00
R0850:Vmn2r93 UTSW 17 18305017 missense possibly damaging 0.93
R0924:Vmn2r93 UTSW 17 18304181 missense probably benign
R0947:Vmn2r93 UTSW 17 18304081 missense probably benign 0.06
R1124:Vmn2r93 UTSW 17 18298448 missense probably benign 0.00
R1584:Vmn2r93 UTSW 17 18305151 missense possibly damaging 0.84
R1943:Vmn2r93 UTSW 17 18325801 missense probably benign 0.04
R2012:Vmn2r93 UTSW 17 18316578 missense probably benign 0.01
R2018:Vmn2r93 UTSW 17 18326062 missense probably damaging 1.00
R2196:Vmn2r93 UTSW 17 18305166 missense probably damaging 1.00
R2373:Vmn2r93 UTSW 17 18298403 missense probably benign
R2864:Vmn2r93 UTSW 17 18326061 missense probably damaging 1.00
R4276:Vmn2r93 UTSW 17 18304830 missense possibly damaging 0.47
R4446:Vmn2r93 UTSW 17 18304050 missense possibly damaging 0.93
R4537:Vmn2r93 UTSW 17 18304932 missense possibly damaging 0.86
R4674:Vmn2r93 UTSW 17 18304993 missense probably benign 0.34
R4726:Vmn2r93 UTSW 17 18316698 missense probably damaging 1.00
R4936:Vmn2r93 UTSW 17 18304065 missense possibly damaging 0.95
R4984:Vmn2r93 UTSW 17 18313127 splice site probably null
R5111:Vmn2r93 UTSW 17 18326064 missense probably damaging 0.99
R5749:Vmn2r93 UTSW 17 18298284 missense probably benign 0.06
R5918:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R5921:Vmn2r93 UTSW 17 18325768 missense probably damaging 1.00
R6091:Vmn2r93 UTSW 17 18325696 missense probably benign 0.06
R6283:Vmn2r93 UTSW 17 18304104 missense probably benign 0.02
R6680:Vmn2r93 UTSW 17 18316658 nonsense probably null
R6876:Vmn2r93 UTSW 17 18305188 missense probably benign 0.00
R6963:Vmn2r93 UTSW 17 18316587 missense probably damaging 1.00
R6996:Vmn2r93 UTSW 17 18304641 missense probably damaging 1.00
R7027:Vmn2r93 UTSW 17 18313286 missense probably benign 0.01
R7034:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7036:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7246:Vmn2r93 UTSW 17 18325750 missense possibly damaging 0.89
R7258:Vmn2r93 UTSW 17 18305141 missense probably benign 0.32
R7323:Vmn2r93 UTSW 17 18313235 nonsense probably null
R7325:Vmn2r93 UTSW 17 18303987 missense probably benign 0.01
R7390:Vmn2r93 UTSW 17 18305067 missense probably damaging 1.00
R7427:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7428:Vmn2r93 UTSW 17 18326410 missense probably benign 0.00
R7448:Vmn2r93 UTSW 17 18325986 missense probably benign 0.19
R7453:Vmn2r93 UTSW 17 18313318 missense probably benign 0.10
R7562:Vmn2r93 UTSW 17 18298469 missense probably benign 0.01
R7662:Vmn2r93 UTSW 17 18305369 missense probably benign 0.00
R7682:Vmn2r93 UTSW 17 18305321 missense probably benign 0.03
R7704:Vmn2r93 UTSW 17 18316648 missense probably benign 0.01
Z1088:Vmn2r93 UTSW 17 18326403 missense probably damaging 1.00
Z1177:Vmn2r93 UTSW 17 18305338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGGACTTTCGGGATAGC -3'
(R):5'- TTGACTCAAGCATCAATATCTCGGG -3'

Sequencing Primer
(F):5'- GGACTTTCGGGATAGCATTTGAAATC -3'
(R):5'- CTCGGGAAAACATAACTGTGTTATC -3'
Posted On2019-11-26