Incidental Mutation 'R7772:Wdr90'
ID598673
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7772 (G1)
Quality Score105.008
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 25861491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026828] [ENSMUST00000079461] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000026828
SMART Domains Protein: ENSMUSP00000026828
Gene: ENSMUSG00000025732

DomainStartEndE-ValueType
Pfam:FAM195 59 158 8.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079461
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176678
Predicted Effect probably benign
Transcript: ENSMUST00000176923
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 T C 3: 105,907,723 V263A probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Arfgef1 A G 1: 10,157,010 V1368A possibly damaging Het
Arid4a A T 12: 71,061,589 N56I possibly damaging Het
Art3 A T 5: 92,403,613 Y277F probably damaging Het
Atp2a1 A T 7: 126,448,535 probably null Het
Banf1 T C 19: 5,365,122 K54E possibly damaging Het
Bckdk A G 7: 127,905,901 Y151C probably damaging Het
C1qtnf3 C A 15: 10,958,044 P58T possibly damaging Het
Cadps2 T C 6: 23,390,446 R744G probably benign Het
Cdc25b A G 2: 131,189,109 D118G probably damaging Het
Cnot9 G A 1: 74,526,992 V181I probably damaging Het
Cobl C T 11: 12,254,488 G738D probably benign Het
Crnkl1 A G 2: 145,930,644 V171A probably benign Het
Dhx57 C T 17: 80,273,078 D482N possibly damaging Het
Drd3 G T 16: 43,762,395 A52S probably benign Het
Dst T C 1: 34,181,388 V2091A possibly damaging Het
Evpl T C 11: 116,221,435 T1810A probably benign Het
Fbxo2 T A 4: 148,164,326 W92R probably damaging Het
Gas2l2 T A 11: 83,429,277 D51V possibly damaging Het
Gm11232 A T 4: 71,756,581 V228E possibly damaging Het
Gm14305 C T 2: 176,720,971 Q219* probably null Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr39 G T 1: 125,677,597 M87I possibly damaging Het
Heatr1 T C 13: 12,417,641 M1089T probably benign Het
Ifi206 A T 1: 173,481,074 M452K Het
Ints8 A T 4: 11,227,190 I561N probably damaging Het
Itgb2 A T 10: 77,561,112 K660N probably benign Het
Jun A C 4: 95,050,844 V143G probably benign Het
Kalrn A G 16: 34,031,582 M2076T probably benign Het
Krt10 G T 11: 99,389,087 S82R unknown Het
Lipm T A 19: 34,117,891 H295Q probably damaging Het
Mybpc2 A C 7: 44,515,924 probably null Het
Nedd4 T C 9: 72,677,326 V103A possibly damaging Het
Nol10 T C 12: 17,348,585 I11T probably damaging Het
Nup210l A G 3: 90,159,926 S758G probably damaging Het
Olfr270 T A 4: 52,970,713 C31S probably damaging Het
Olfr584 T G 7: 103,086,181 I216S probably benign Het
Olfr985 T C 9: 40,127,365 I199V probably benign Het
Osbpl9 T C 4: 109,066,187 H425R probably damaging Het
Parp1 G T 1: 180,589,398 R582S possibly damaging Het
Piwil1 A T 5: 128,739,463 R36S probably benign Het
Pjvk T C 2: 76,657,533 probably null Het
Plekha6 G T 1: 133,170,022 E31D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Psmc6 T A 14: 45,343,650 I301N probably damaging Het
Rfpl4 C A 7: 5,115,544 S9I probably benign Het
Rnf14 G T 18: 38,309,576 C310F probably damaging Het
Rnf17 T A 14: 56,477,687 F845L probably benign Het
Robo2 T C 16: 73,961,889 I665V probably benign Het
Rtl1 T A 12: 109,593,185 H740L probably damaging Het
Ryr2 A G 13: 11,751,011 S1280P probably benign Het
Slc12a8 G A 16: 33,550,965 R126H probably damaging Het
Slc9a1 T C 4: 133,411,965 F165L probably damaging Het
Snx19 T C 9: 30,428,925 I453T probably damaging Het
Spag17 T C 3: 100,080,118 Y1575H probably damaging Het
Spef2 T C 15: 9,704,481 I415M probably damaging Het
Ssx2ip T G 3: 146,433,130 I459S probably damaging Het
Tmem156 A T 5: 65,080,174 S48T probably damaging Het
Unc93a A T 17: 13,109,752 F405I possibly damaging Het
Vmn1r209 T A 13: 22,806,494 I9F possibly damaging Het
Vmn2r93 A G 17: 18,313,220 D462G probably damaging Het
Zfp551 T C 7: 12,418,608 D66G probably damaging Het
Znrf4 A C 17: 56,512,247 V20G possibly damaging Het
Zscan4d T C 7: 11,162,843 E200G probably benign Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
R7870:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7911:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R7953:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7992:Wdr90 UTSW 17 25850749 missense probably benign 0.00
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 25860496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTGAGGAAAGGGTGCTGC -3'
(R):5'- CTTAGCACAGTTCCCTGCACAG -3'

Sequencing Primer
(F):5'- AAAGGGTGCTGCCAGGC -3'
(R):5'- AGTTCCCTGCACAGTGCTGAG -3'
Posted On2019-11-26