Incidental Mutation 'R7773:Cnnm4'
ID598679
Institutional Source Beutler Lab
Gene Symbol Cnnm4
Ensembl Gene ENSMUSG00000037408
Gene Namecyclin M4
Synonyms5430430O18Rik, Acdp4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36471620-36508764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36499522 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 595 (V595A)
Ref Sequence ENSEMBL: ENSMUSP00000121317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153128]
Predicted Effect probably benign
Transcript: ENSMUST00000153128
AA Change: V595A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121317
Gene: ENSMUSG00000037408
AA Change: V595A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:DUF21 181 355 1.1e-35 PFAM
SCOP:d1jr1a3 373 424 1e-3 SMART
Blast:CBS 379 429 9e-13 BLAST
Pfam:CBS 438 502 6.9e-4 PFAM
Blast:cNMP 572 705 2e-72 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play a role in metal ion transport. Mutations in this gene are associated with Jalili syndrome which consists of cone-rod dystrophy and amelogenesis imperfecta. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutants exhibit hypomagnesemia and defective amelogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Cnnm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Cnnm4 APN 1 36498034 missense possibly damaging 0.95
IGL01534:Cnnm4 APN 1 36499515 missense probably benign
IGL02201:Cnnm4 APN 1 36472750 missense probably damaging 1.00
IGL03090:Cnnm4 APN 1 36471871 missense probably benign 0.00
IGL03173:Cnnm4 APN 1 36473092 splice site probably benign
R0372:Cnnm4 UTSW 1 36498010 missense probably damaging 1.00
R1659:Cnnm4 UTSW 1 36472165 missense probably benign 0.00
R2239:Cnnm4 UTSW 1 36505678 missense probably benign 0.00
R2986:Cnnm4 UTSW 1 36472372 missense possibly damaging 0.92
R4195:Cnnm4 UTSW 1 36499508 missense probably benign 0.06
R4890:Cnnm4 UTSW 1 36472264 missense probably benign 0.35
R6109:Cnnm4 UTSW 1 36498479 missense probably damaging 1.00
R6302:Cnnm4 UTSW 1 36499955 missense probably benign
R7836:Cnnm4 UTSW 1 36471938 missense probably benign
R8041:Cnnm4 UTSW 1 36472093 missense probably benign 0.01
R8222:Cnnm4 UTSW 1 36506536 missense probably benign 0.04
X0011:Cnnm4 UTSW 1 36472906 missense probably damaging 1.00
Z1176:Cnnm4 UTSW 1 36505751 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTGAAGAAATGGCCCAAGC -3'
(R):5'- GCAAGCACATTCAAGGGTAG -3'

Sequencing Primer
(F):5'- CTAGTACAGAGTGGCGTGGTCAC -3'
(R):5'- CATTCAAGGGTAGGCCGTAGACTC -3'
Posted On2019-11-26