Incidental Mutation 'R7773:Tsga10'
ID598680
Institutional Source Beutler Lab
Gene Symbol Tsga10
Ensembl Gene ENSMUSG00000060771
Gene Nametestis specific 10
Synonyms4933432N21Rik, Mtsga10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37754776-37866429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37835242 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 159 (C159S)
Ref Sequence ENSEMBL: ENSMUSP00000141261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041815] [ENSMUST00000088072] [ENSMUST00000114902] [ENSMUST00000123082] [ENSMUST00000151735] [ENSMUST00000155852] [ENSMUST00000193669]
Predicted Effect probably benign
Transcript: ENSMUST00000041815
SMART Domains Protein: ENSMUSP00000048859
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088072
SMART Domains Protein: ENSMUSP00000085391
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114902
SMART Domains Protein: ENSMUSP00000110552
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000123082
AA Change: C159S
SMART Domains Protein: ENSMUSP00000141261
Gene: ENSMUSG00000060771
AA Change: C159S

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151735
SMART Domains Protein: ENSMUSP00000120554
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 229 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155852
AA Change: C159S
SMART Domains Protein: ENSMUSP00000141630
Gene: ENSMUSG00000060771
AA Change: C159S

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193669
AA Change: C159S
SMART Domains Protein: ENSMUSP00000142218
Gene: ENSMUSG00000060771
AA Change: C159S

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 157 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Tsga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tsga10 APN 1 37807070 missense probably damaging 0.99
IGL00579:Tsga10 APN 1 37835453 missense probably damaging 1.00
IGL00837:Tsga10 APN 1 37801911 splice site probably benign
IGL01577:Tsga10 APN 1 37835457 missense possibly damaging 0.85
IGL01727:Tsga10 APN 1 37835274 missense probably damaging 1.00
IGL02037:Tsga10 APN 1 37807017 missense probably benign 0.05
IGL02510:Tsga10 APN 1 37760985 missense possibly damaging 0.89
R0346:Tsga10 UTSW 1 37840519 missense possibly damaging 0.65
R0789:Tsga10 UTSW 1 37801787 missense possibly damaging 0.87
R0961:Tsga10 UTSW 1 37761428 critical splice donor site probably null
R1370:Tsga10 UTSW 1 37835453 missense probably damaging 1.00
R1440:Tsga10 UTSW 1 37819599 missense probably damaging 1.00
R1827:Tsga10 UTSW 1 37835580 missense probably damaging 1.00
R2504:Tsga10 UTSW 1 37815677 missense probably damaging 1.00
R3104:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3105:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3106:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3824:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R3825:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R4560:Tsga10 UTSW 1 37807082 missense probably benign 0.00
R4773:Tsga10 UTSW 1 37835525 missense probably damaging 1.00
R4927:Tsga10 UTSW 1 37801850 missense probably damaging 1.00
R5036:Tsga10 UTSW 1 37783968 missense possibly damaging 0.65
R5326:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5345:Tsga10 UTSW 1 37763311 missense probably damaging 1.00
R5503:Tsga10 UTSW 1 37760947 makesense probably null
R5542:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5793:Tsga10 UTSW 1 37835459 missense probably damaging 1.00
R6340:Tsga10 UTSW 1 37835185 intron probably benign
R7096:Tsga10 UTSW 1 37840614 missense probably damaging 0.98
R7130:Tsga10 UTSW 1 37783884 missense probably damaging 1.00
R7401:Tsga10 UTSW 1 37834187 missense probably null 1.00
R7609:Tsga10 UTSW 1 37804893 intron probably null
R7649:Tsga10 UTSW 1 37835148 missense unknown
R8242:Tsga10 UTSW 1 37807101 missense probably benign 0.28
R8379:Tsga10 UTSW 1 37801878 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCCTGTTTCTAGAGGAGAC -3'
(R):5'- GCCTTCACTGACCTACGAAG -3'

Sequencing Primer
(F):5'- CCCTGTTTCTAGAGGAGACTAACTG -3'
(R):5'- CCACAGAGCGAGACAGTCTG -3'
Posted On2019-11-26