Incidental Mutation 'R7773:Rnf149'
ID598681
Institutional Source Beutler Lab
Gene Symbol Rnf149
Ensembl Gene ENSMUSG00000048234
Gene Namering finger protein 149
Synonyms1600023E10Rik, Greul4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location39551296-39577405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 39565218 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 188 (M188R)
Ref Sequence ENSEMBL: ENSMUSP00000050388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062525] [ENSMUST00000195136] [ENSMUST00000195705]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062525
AA Change: M188R

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050388
Gene: ENSMUSG00000048234
AA Change: M188R

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:PA 72 169 3.9e-13 PFAM
transmembrane domain 196 218 N/A INTRINSIC
RING 265 305 2.09e-7 SMART
low complexity region 347 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195136
AA Change: M31R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141667
Gene: ENSMUSG00000048234
AA Change: M31R

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
SCOP:d1ldjb_ 74 127 3e-3 SMART
Blast:RING 108 127 9e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195705
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Rnf149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02586:Rnf149 APN 1 39565215 missense probably benign 0.19
R1316:Rnf149 UTSW 1 39565320 makesense probably null
R2917:Rnf149 UTSW 1 39552483 missense probably benign 0.00
R4690:Rnf149 UTSW 1 39577214 intron probably benign
R5095:Rnf149 UTSW 1 39555656 missense probably benign 0.19
R6084:Rnf149 UTSW 1 39577174 missense probably benign 0.01
R6338:Rnf149 UTSW 1 39560742 missense probably null 1.00
R8090:Rnf149 UTSW 1 39577223 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTACCTGCAGAAACCAAATG -3'
(R):5'- CAGACTCTGTTCTCTTTTGGAATCAG -3'

Sequencing Primer
(F):5'- TGTGGTTAAATGTAACTTCAAGTAGC -3'
(R):5'- TGTGCACTTTGATGAACATACTC -3'
Posted On2019-11-26