Incidental Mutation 'R7773:Edem3'
ID598683
Institutional Source Beutler Lab
Gene Symbol Edem3
Ensembl Gene ENSMUSG00000043019
Gene NameER degradation enhancer, mannosidase alpha-like 3
Synonyms2310050N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location151755371-151822051 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 151811596 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 762 (K762*)
Ref Sequence ENSEMBL: ENSMUSP00000058941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059498] [ENSMUST00000187951] [ENSMUST00000188145] [ENSMUST00000191070]
Predicted Effect probably null
Transcript: ENSMUST00000059498
AA Change: K762*
SMART Domains Protein: ENSMUSP00000058941
Gene: ENSMUSG00000043019
AA Change: K762*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.5e-118 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 672 778 9.4e-16 PFAM
low complexity region 838 855 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187951
AA Change: K744*
SMART Domains Protein: ENSMUSP00000140775
Gene: ENSMUSG00000043019
AA Change: K744*

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 1.8e-147 PFAM
low complexity region 617 630 N/A INTRINSIC
Pfam:PA 658 762 1.6e-17 PFAM
low complexity region 820 837 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188145
AA Change: K762*
SMART Domains Protein: ENSMUSP00000140443
Gene: ENSMUSG00000043019
AA Change: K762*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3.3e-144 PFAM
low complexity region 635 648 N/A INTRINSIC
Pfam:PA 676 780 4.3e-15 PFAM
low complexity region 854 871 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191070
AA Change: K743*
SMART Domains Protein: ENSMUSP00000140234
Gene: ENSMUSG00000043019
AA Change: K743*

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:Glyco_hydro_47 60 499 3e-144 PFAM
low complexity region 616 629 N/A INTRINSIC
Pfam:PA 657 761 4.1e-15 PFAM
low complexity region 824 841 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Quality control in the endoplasmic reticulum (ER) ensures that only properly folded proteins are retained in the cell through recognition and degradation of misfolded or unassembled proteins. EDEM3 belongs to a group of proteins that accelerate degradation of misfolded glycoproteins in the ER (Hirao et al., 2006 [PubMed 16431915]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Edem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Edem3 APN 1 151818513 missense probably benign
IGL01065:Edem3 APN 1 151777551 missense probably damaging 1.00
IGL01351:Edem3 APN 1 151792385 missense possibly damaging 0.95
IGL01451:Edem3 APN 1 151818628 missense probably benign 0.21
IGL01831:Edem3 APN 1 151796082 missense probably damaging 0.97
IGL02096:Edem3 APN 1 151804719 missense probably benign 0.00
IGL02207:Edem3 APN 1 151808360 missense possibly damaging 0.77
IGL02507:Edem3 APN 1 151811656 missense probably benign 0.20
IGL02690:Edem3 APN 1 151804799 missense probably damaging 1.00
R5205_edem3_101 UTSW 1 151811519 missense probably damaging 1.00
R0421:Edem3 UTSW 1 151792438 splice site probably benign
R1463:Edem3 UTSW 1 151807510 missense possibly damaging 0.81
R1934:Edem3 UTSW 1 151804283 missense probably damaging 1.00
R1958:Edem3 UTSW 1 151804325 missense probably damaging 1.00
R2090:Edem3 UTSW 1 151804826 splice site probably benign
R2126:Edem3 UTSW 1 151794731 missense possibly damaging 0.76
R2191:Edem3 UTSW 1 151796883 missense probably damaging 1.00
R2211:Edem3 UTSW 1 151804702 missense possibly damaging 0.74
R4005:Edem3 UTSW 1 151759755 missense probably damaging 1.00
R4018:Edem3 UTSW 1 151804826 splice site probably benign
R4723:Edem3 UTSW 1 151804698 missense possibly damaging 0.95
R4818:Edem3 UTSW 1 151792385 missense possibly damaging 0.95
R4871:Edem3 UTSW 1 151804231 splice site probably null
R5205:Edem3 UTSW 1 151811519 missense probably damaging 1.00
R5347:Edem3 UTSW 1 151807451 missense probably damaging 0.97
R5910:Edem3 UTSW 1 151770827 splice site probably null
R7021:Edem3 UTSW 1 151755672 missense probably benign 0.01
R7366:Edem3 UTSW 1 151812614 splice site probably null
R7481:Edem3 UTSW 1 151808222 missense probably damaging 0.98
R7481:Edem3 UTSW 1 151808223 missense possibly damaging 0.46
R7734:Edem3 UTSW 1 151818585 missense probably benign 0.00
R7828:Edem3 UTSW 1 151811635 missense possibly damaging 0.51
X0028:Edem3 UTSW 1 151818562 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GCAGTCTAGAAAACTTCTTTTGCTG -3'
(R):5'- ATTGTTCCTTGCTTTACCAGTGAAC -3'

Sequencing Primer
(F):5'- GCTGCTTTCAATTATTTCCTTGGG -3'
(R):5'- CCTTGCTTTACCAGTGAACTAAAAG -3'
Posted On2019-11-26