Incidental Mutation 'R7773:Gon4l'
ID598692
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R7773 (G1)
Quality Score140.008
Status Not validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88895795 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1238 (K1238E)
Ref Sequence ENSEMBL: ENSMUSP00000103122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107498]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
AA Change: K1238E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199
AA Change: K1238E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090942
AA Change: K1239E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199
AA Change: K1239E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107498
AA Change: K1238E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199
AA Change: K1238E

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212694
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4569:Gon4l UTSW 3 88910090 intron probably benign
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
R7635:Gon4l UTSW 3 88895106 missense probably benign 0.03
R7643:Gon4l UTSW 3 88902807 missense probably damaging 1.00
R7715:Gon4l UTSW 3 88908006 missense probably benign
R8090:Gon4l UTSW 3 88892624 missense probably damaging 1.00
R8224:Gon4l UTSW 3 88895142 missense probably damaging 1.00
R8260:Gon4l UTSW 3 88892630 missense probably damaging 0.98
Z1177:Gon4l UTSW 3 88859036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGTTAGTGCAGCTGTG -3'
(R):5'- CACAGGCACTCTTTTCAGAAG -3'

Sequencing Primer
(F):5'- TTAGTGCAGCTGTGGCACC -3'
(R):5'- TTTCAGAAGAGCCTTCCTGG -3'
Posted On2019-11-26