Incidental Mutation 'R7773:Sod3'
ID598699
Institutional Source Beutler Lab
Gene Symbol Sod3
Ensembl Gene ENSMUSG00000072941
Gene Namesuperoxide dismutase 3, extracellular
SynonymsEC-SOD
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location52363791-52371418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52368301 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 114 (E114A)
Ref Sequence ENSEMBL: ENSMUSP00000098768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101208]
PDB Structure
[]
[]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101208
AA Change: E114A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098768
Gene: ENSMUSG00000072941
AA Change: E114A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sod_Cu 85 224 1.5e-32 PFAM
low complexity region 233 251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to hyperoxia, increased LPS-stimulated spleen production of TNF, and enhanced severity of collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Sod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Sod3 APN 5 52368198 nonsense probably null
IGL02894:Sod3 APN 5 52368006 missense possibly damaging 0.70
R0646:Sod3 UTSW 5 52368079 missense probably benign 0.02
R1822:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1823:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1824:Sod3 UTSW 5 52368162 missense probably benign 0.07
R3872:Sod3 UTSW 5 52368289 missense probably damaging 0.98
R3934:Sod3 UTSW 5 52368645 missense probably benign 0.00
R4969:Sod3 UTSW 5 52368394 missense probably damaging 1.00
R6899:Sod3 UTSW 5 52368708 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCAAAGTGCTGGAGATCTG -3'
(R):5'- TGGTTGCCACCTTTACCCAG -3'

Sequencing Primer
(F):5'- TCTGGATGGAGCTAGGACGAC -3'
(R):5'- CACAGAGCGGCCCAAGATG -3'
Posted On2019-11-26