Incidental Mutation 'R7773:Lrrc66'
ID598700
Institutional Source Beutler Lab
Gene Symbol Lrrc66
Ensembl Gene ENSMUSG00000067206
Gene Nameleucine rich repeat containing 66
SynonymsMGC:38937
MMRRC Submission
Accession Numbers

Genbank: NM_153568; MGI: 2387634

Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location73606642-73632526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73607321 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 793 (S793F)
Ref Sequence ENSEMBL: ENSMUSP00000084423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087177]
Predicted Effect probably damaging
Transcript: ENSMUST00000087177
AA Change: S793F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084423
Gene: ENSMUSG00000067206
AA Change: S793F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 140 162 1.81e1 SMART
LRR_TYP 163 186 9.44e-2 SMART
LRR 187 210 1.26e2 SMART
LRR 211 234 4.84e1 SMART
low complexity region 298 309 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 842 859 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Lrrc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Lrrc66 APN 5 73607114 missense probably benign 0.10
IGL00913:Lrrc66 APN 5 73608156 missense possibly damaging 0.76
IGL00954:Lrrc66 APN 5 73608398 missense possibly damaging 0.94
IGL01061:Lrrc66 APN 5 73615499 missense probably benign 0.01
IGL01343:Lrrc66 APN 5 73608463 missense probably damaging 0.98
IGL01714:Lrrc66 APN 5 73629977 missense probably benign 0.10
IGL01822:Lrrc66 APN 5 73629968 missense probably benign 0.17
IGL02005:Lrrc66 APN 5 73608734 missense possibly damaging 0.83
IGL02166:Lrrc66 APN 5 73607291 missense probably damaging 0.99
IGL02380:Lrrc66 APN 5 73629666 missense possibly damaging 0.55
IGL03162:Lrrc66 APN 5 73607382 missense probably benign
BB002:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
BB012:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
D4043:Lrrc66 UTSW 5 73607526 missense probably benign 0.03
R0126:Lrrc66 UTSW 5 73607088 missense probably benign 0.10
R0437:Lrrc66 UTSW 5 73607687 missense probably benign 0.23
R0638:Lrrc66 UTSW 5 73615473 splice site probably benign
R0658:Lrrc66 UTSW 5 73610944 missense probably benign 0.40
R0729:Lrrc66 UTSW 5 73608414 missense probably benign
R1603:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1774:Lrrc66 UTSW 5 73610855 missense probably benign 0.16
R1831:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1832:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1902:Lrrc66 UTSW 5 73607622 missense probably damaging 0.99
R2858:Lrrc66 UTSW 5 73607303 missense probably benign 0.08
R4097:Lrrc66 UTSW 5 73607704 missense possibly damaging 0.94
R4164:Lrrc66 UTSW 5 73629776 splice site probably null
R4582:Lrrc66 UTSW 5 73608237 missense possibly damaging 0.94
R4708:Lrrc66 UTSW 5 73629662 missense probably benign 0.06
R4856:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R4886:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R5074:Lrrc66 UTSW 5 73608011 missense probably damaging 1.00
R5464:Lrrc66 UTSW 5 73608279 missense probably benign 0.05
R5640:Lrrc66 UTSW 5 73608634 missense probably benign 0.00
R5709:Lrrc66 UTSW 5 73608863 missense probably benign
R5811:Lrrc66 UTSW 5 73615517 missense possibly damaging 0.82
R6146:Lrrc66 UTSW 5 73608089 missense probably benign 0.10
R7037:Lrrc66 UTSW 5 73607161 missense probably benign 0.10
R7041:Lrrc66 UTSW 5 73608556 missense possibly damaging 0.81
R7141:Lrrc66 UTSW 5 73629977 missense probably benign 0.10
R7201:Lrrc66 UTSW 5 73629897 missense probably benign 0.11
R7250:Lrrc66 UTSW 5 73610881 missense probably benign 0.03
R7367:Lrrc66 UTSW 5 73608381 missense probably benign 0.13
R7925:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
R8057:Lrrc66 UTSW 5 73607532 nonsense probably null
R8167:Lrrc66 UTSW 5 73629609 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATGGTGAACTATCTACATTTGGG -3'
(R):5'- ACACAAGGAGCTTGGCTGAG -3'

Sequencing Primer
(F):5'- GTGAACTATCTACATTTGGGGATTCC -3'
(R):5'- AATGATGGGACCAGCCAGCC -3'
Posted On2019-11-26