Incidental Mutation 'R7773:Aoc1'
ID598704
Institutional Source Beutler Lab
Gene Symbol Aoc1
Ensembl Gene ENSMUSG00000029811
Gene Nameamine oxidase, copper-containing 1
SynonymsAbp1, 1600012D06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48872896-48909188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48906212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 341 (I341V)
Ref Sequence ENSEMBL: ENSMUSP00000031835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031835] [ENSMUST00000162948] [ENSMUST00000167529] [ENSMUST00000204856]
Predicted Effect probably benign
Transcript: ENSMUST00000031835
AA Change: I341V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031835
Gene: ENSMUSG00000029811
AA Change: I341V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162948
AA Change: I341V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000124085
Gene: ENSMUSG00000029811
AA Change: I341V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167529
AA Change: I341V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128816
Gene: ENSMUSG00000029811
AA Change: I341V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 2.4e-30 PFAM
Pfam:Cu_amine_oxidN3 146 246 1.5e-23 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 717 1.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204856
SMART Domains Protein: ENSMUSP00000144764
Gene: ENSMUSG00000029811

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 4.3e-28 PFAM
Pfam:Cu_amine_oxidN3 168 250 8.9e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Aoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Aoc1 APN 6 48908664 missense possibly damaging 0.92
IGL01115:Aoc1 APN 6 48906197 missense probably damaging 1.00
IGL01626:Aoc1 APN 6 48906531 missense probably damaging 1.00
IGL01891:Aoc1 APN 6 48908842 unclassified probably benign
IGL01908:Aoc1 APN 6 48906756 missense probably damaging 1.00
IGL01919:Aoc1 APN 6 48908289 missense probably damaging 1.00
IGL01960:Aoc1 APN 6 48908603 missense probably benign 0.00
IGL02102:Aoc1 APN 6 48905962 missense probably damaging 0.99
IGL02121:Aoc1 APN 6 48906320 unclassified probably null
IGL02229:Aoc1 APN 6 48905909 nonsense probably null
IGL02325:Aoc1 APN 6 48905895 missense possibly damaging 0.46
IGL02626:Aoc1 APN 6 48906110 missense probably benign 0.04
IGL02737:Aoc1 APN 6 48907643 missense probably benign 0.01
IGL03244:Aoc1 APN 6 48905822 missense possibly damaging 0.79
IGL03371:Aoc1 APN 6 48906446 missense probably benign 0.05
R0100:Aoc1 UTSW 6 48908604 missense possibly damaging 0.92
R0835:Aoc1 UTSW 6 48905514 missense probably damaging 1.00
R1240:Aoc1 UTSW 6 48905615 missense probably benign 0.10
R1400:Aoc1 UTSW 6 48906283 nonsense probably null
R1400:Aoc1 UTSW 6 48906711 missense probably benign
R1443:Aoc1 UTSW 6 48905445 missense possibly damaging 0.95
R1447:Aoc1 UTSW 6 48906242 missense probably benign 0.00
R1572:Aoc1 UTSW 6 48905786 missense possibly damaging 0.48
R1850:Aoc1 UTSW 6 48905268 missense probably benign 0.19
R2008:Aoc1 UTSW 6 48905897 missense probably damaging 1.00
R2256:Aoc1 UTSW 6 48906440 missense possibly damaging 0.95
R3429:Aoc1 UTSW 6 48906076 missense probably benign
R3430:Aoc1 UTSW 6 48906076 missense probably benign
R3432:Aoc1 UTSW 6 48905844 missense probably damaging 1.00
R3783:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3786:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3787:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R4024:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4025:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4455:Aoc1 UTSW 6 48905467 missense probably damaging 0.98
R4510:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4511:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4525:Aoc1 UTSW 6 48906675 missense probably damaging 1.00
R4659:Aoc1 UTSW 6 48906076 missense probably benign
R4876:Aoc1 UTSW 6 48906747 missense possibly damaging 0.78
R5150:Aoc1 UTSW 6 48906150 missense possibly damaging 0.88
R5153:Aoc1 UTSW 6 48908747 missense probably benign 0.19
R5437:Aoc1 UTSW 6 48907750 missense probably benign 0.00
R6000:Aoc1 UTSW 6 48907639 missense probably benign 0.05
R6112:Aoc1 UTSW 6 48908691 missense probably damaging 1.00
R6195:Aoc1 UTSW 6 48908677 missense probably damaging 1.00
R6252:Aoc1 UTSW 6 48906081 missense probably benign 0.01
R6703:Aoc1 UTSW 6 48905714 missense probably damaging 1.00
R6748:Aoc1 UTSW 6 48906294 missense possibly damaging 0.84
R6765:Aoc1 UTSW 6 48905937 missense probably benign 0.00
R6935:Aoc1 UTSW 6 48908227 missense probably damaging 1.00
R7002:Aoc1 UTSW 6 48905876 missense probably benign
R7066:Aoc1 UTSW 6 48908619 missense probably damaging 1.00
R7120:Aoc1 UTSW 6 48906597 missense probably damaging 1.00
R7234:Aoc1 UTSW 6 48905816 nonsense probably null
R7362:Aoc1 UTSW 6 48905411 missense probably benign 0.18
R7452:Aoc1 UTSW 6 48908790 missense probably benign 0.11
R7618:Aoc1 UTSW 6 48906386 missense possibly damaging 0.71
R7821:Aoc1 UTSW 6 48905811 missense probably damaging 1.00
R7837:Aoc1 UTSW 6 48905650 nonsense probably null
R8010:Aoc1 UTSW 6 48905648 missense probably benign 0.40
X0066:Aoc1 UTSW 6 48908252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGTGGTTCTCGAGGAC -3'
(R):5'- AAAGTAGCGGTCTCTGGACAG -3'

Sequencing Primer
(F):5'- TGGTTCTCGAGGACCCACTG -3'
(R):5'- TAGCGGTCTCTGGACAGTCAATAC -3'
Posted On2019-11-26