Incidental Mutation 'R7773:Cd8a'
ID598707
Institutional Source Beutler Lab
Gene Symbol Cd8a
Ensembl Gene ENSMUSG00000053977
Gene NameCD8 antigen, alpha chain
SynonymsLy-35, Lyt-2, Ly-B, Ly-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71373427-71379173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71373815 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 88 (N88S)
Ref Sequence ENSEMBL: ENSMUSP00000068123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066747] [ENSMUST00000172321]
PDB Structure
MURINE CD8AA ECTODOMAIN FRAGMENT IN COMPLEX WITH H-2KB/VSV8 [X-RAY DIFFRACTION]
The Crystal Structure of a TL/CD8aa Complex at 2.1A resolution:Implications for Memory T cell Generation, Co-receptor Preference and Affinity [X-RAY DIFFRACTION]
CD8alpha-alpha in complex with YTS 105.18 Fab [X-RAY DIFFRACTION]
Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION]
Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION]
Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000066747
AA Change: N88S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000068123
Gene: ENSMUSG00000053977
AA Change: N88S

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172321
AA Change: N88S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131873
Gene: ENSMUSG00000053977
AA Change: N88S

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Pcm1 G T 8: 41,309,573 E1385* probably null Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Cd8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cd8a APN 6 71373707 missense probably benign 0.04
IGL02342:Cd8a APN 6 71373739 missense probably damaging 1.00
Alfalfa UTSW 6 71373728 missense probably damaging 0.99
Sprouts UTSW 6 71373929 missense probably damaging 0.97
wenzhou UTSW 6 71373872 missense probably benign 0.02
PIT4618001:Cd8a UTSW 6 71373677 missense possibly damaging 0.94
R0212:Cd8a UTSW 6 71373649 missense probably benign 0.01
R1158:Cd8a UTSW 6 71373728 missense probably damaging 0.99
R1813:Cd8a UTSW 6 71373963 missense possibly damaging 0.47
R4541:Cd8a UTSW 6 71373872 missense probably benign 0.02
R5836:Cd8a UTSW 6 71373791 missense possibly damaging 0.48
R6390:Cd8a UTSW 6 71373929 missense probably damaging 0.97
R6889:Cd8a UTSW 6 71374562 missense probably damaging 1.00
Z1088:Cd8a UTSW 6 71373686 missense possibly damaging 0.85
Z1177:Cd8a UTSW 6 71374593 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTGGGTGAGTCGATTATCC -3'
(R):5'- TTTCTGAAGGACTGGCACG -3'

Sequencing Primer
(F):5'- TTATCCTGGGGAGTGGAGAAGC -3'
(R):5'- CTGGCACGACAGAACTGAAGTAC -3'
Posted On2019-11-26