Incidental Mutation 'R7773:Pcm1'
ID598715
Institutional Source Beutler Lab
Gene Symbol Pcm1
Ensembl Gene ENSMUSG00000031592
Gene Namepericentriolar material 1
Synonyms9430077F19Rik, 2600002H09Rik, C030044G17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_023662; MGI: 1277958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7773 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location41239752-41332344 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 41309573 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1385 (E1385*)
Ref Sequence ENSEMBL: ENSMUSP00000039709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045218] [ENSMUST00000211247]
Predicted Effect probably null
Transcript: ENSMUST00000045218
AA Change: E1385*
SMART Domains Protein: ENSMUSP00000039709
Gene: ENSMUSG00000031592
AA Change: E1385*

DomainStartEndE-ValueType
coiled coil region 218 238 N/A INTRINSIC
coiled coil region 270 301 N/A INTRINSIC
coiled coil region 399 426 N/A INTRINSIC
coiled coil region 492 520 N/A INTRINSIC
low complexity region 527 548 N/A INTRINSIC
low complexity region 622 647 N/A INTRINSIC
coiled coil region 652 683 N/A INTRINSIC
coiled coil region 724 772 N/A INTRINSIC
coiled coil region 822 856 N/A INTRINSIC
coiled coil region 988 1017 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
Pfam:PCM1_C 1369 1999 3.6e-295 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211247
AA Change: E1424*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of centriolar satellites, which are electron dense granules scattered around centrosomes. Inhibition studies show that this protein is essential for the correct localization of several centrosomal proteins, and for anchoring microtubules to the centrosome. Chromosomal aberrations involving this gene are associated with papillary thyroid carcinomas and a variety of hematological malignancies, including atypical chronic myeloid leukemia and T-cell lymphoma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A G 3: 124,412,531 I336T probably benign Het
4930519P11Rik T C 2: 154,613,187 Y84C unknown Het
4930568D16Rik C T 2: 35,354,594 G249S probably damaging Het
4933425L06Rik A G 13: 105,082,285 I42M probably damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agbl1 T A 7: 76,698,837 V894E unknown Het
Amigo3 T C 9: 108,054,668 L430P probably benign Het
Aoc1 A G 6: 48,906,212 I341V probably benign Het
Bod1l A G 5: 41,832,712 S223P probably benign Het
Cacnb3 T C 15: 98,639,938 probably null Het
Ccdc63 G T 5: 122,109,272 N503K probably damaging Het
Ccdc83 T A 7: 90,229,912 I225F probably damaging Het
Cd200r1 A G 16: 44,789,687 T90A possibly damaging Het
Cd8a A G 6: 71,373,815 N88S probably benign Het
Cep170 A G 1: 176,740,076 V152A Het
Chid1 T C 7: 141,529,605 M123V probably benign Het
Cnnm4 T C 1: 36,499,522 V595A probably benign Het
Coro7 A G 16: 4,632,006 L630P probably damaging Het
Cpvl A G 6: 53,931,905 probably null Het
Edem3 A T 1: 151,811,596 K762* probably null Het
Elp6 T A 9: 110,312,559 probably null Het
Emilin3 A T 2: 160,910,798 Y77* probably null Het
Fam234b T A 6: 135,243,914 I641N probably benign Het
Farsa T C 8: 84,864,152 probably null Het
Foxf2 T C 13: 31,627,199 S374P probably benign Het
Gm11596 A T 11: 99,792,841 I151N unknown Het
Gm13178 A T 4: 144,703,477 L314Q probably damaging Het
Gm853 T C 4: 130,220,376 N83D probably damaging Het
Gm9817 C T 13: 45,078,951 Q77* probably null Het
Gon4l A G 3: 88,895,795 K1238E probably benign Het
H13 A G 2: 152,695,511 Y292C probably damaging Het
Hip1r A G 5: 124,001,441 N928S probably benign Het
Iqcf4 T C 9: 106,568,613 N112D probably benign Het
Jak3 A C 8: 71,679,042 T125P probably benign Het
Krt7 A C 15: 101,414,032 K124Q possibly damaging Het
Lrrc66 G A 5: 73,607,321 S793F probably damaging Het
Mycbp2 C T 14: 103,248,404 V1074I probably damaging Het
Nckap5 T C 1: 126,026,844 D657G probably benign Het
Olfr1053 T C 2: 86,314,690 I199V probably benign Het
Olfr1467 T A 19: 13,365,234 V202E probably benign Het
Osbpl7 A G 11: 97,050,722 S24G probably benign Het
Poc5 A G 13: 96,410,635 T469A probably damaging Het
Ppp3ca A G 3: 136,890,461 T296A probably benign Het
Prl6a1 T C 13: 27,318,142 I164T probably damaging Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Rnf149 A C 1: 39,565,218 M188R possibly damaging Het
Rpl10l T C 12: 66,284,267 I31V probably benign Het
Serinc5 T C 13: 92,661,084 S32P probably damaging Het
Sirt1 T A 10: 63,326,783 K137M possibly damaging Het
Smc4 A G 3: 69,016,163 Y251C probably damaging Het
Sod3 A C 5: 52,368,301 E114A possibly damaging Het
Tgfbr3 A G 5: 107,140,502 V431A probably benign Het
Tlr4 T C 4: 66,839,599 S210P probably damaging Het
Trub2 G T 2: 29,786,508 T70N probably benign Het
Tsga10 A T 1: 37,835,242 C159S unknown Het
Vmn1r15 A T 6: 57,258,659 I171F probably benign Het
Vmn2r50 T A 7: 10,037,635 H713L possibly damaging Het
Zcchc14 T C 8: 121,651,775 S43G unknown Het
Zfp638 T C 6: 83,979,214 I1601T probably damaging Het
Other mutations in Pcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pcm1 APN 8 41274277 missense probably damaging 1.00
IGL00852:Pcm1 APN 8 41287821 missense probably damaging 1.00
IGL00896:Pcm1 APN 8 41276123 missense possibly damaging 0.70
IGL00927:Pcm1 APN 8 41287881 missense probably damaging 1.00
IGL01085:Pcm1 APN 8 41309603 missense probably damaging 1.00
IGL01684:Pcm1 APN 8 41257923 missense probably benign 0.00
IGL01888:Pcm1 APN 8 41257956 missense probably damaging 0.98
IGL02349:Pcm1 APN 8 41288155 critical splice donor site probably null
IGL02562:Pcm1 APN 8 41325368 missense probably damaging 1.00
IGL02807:Pcm1 APN 8 41330882 missense probably damaging 1.00
IGL03081:Pcm1 APN 8 41275060 missense probably damaging 1.00
shaved UTSW 8 41288156 critical splice donor site probably null
D3080:Pcm1 UTSW 8 41275939 missense probably damaging 1.00
P0045:Pcm1 UTSW 8 41288097 missense probably damaging 0.99
R0090:Pcm1 UTSW 8 41256041 missense probably damaging 0.99
R0109:Pcm1 UTSW 8 41257937 missense possibly damaging 0.88
R0373:Pcm1 UTSW 8 41276111 nonsense probably null
R0386:Pcm1 UTSW 8 41316023 missense probably damaging 1.00
R0452:Pcm1 UTSW 8 41325905 missense probably benign 0.25
R0498:Pcm1 UTSW 8 41293769 missense probably benign 0.01
R0528:Pcm1 UTSW 8 41315930 missense probably damaging 1.00
R0587:Pcm1 UTSW 8 41286051 missense probably damaging 0.99
R0635:Pcm1 UTSW 8 41267179 splice site probably benign
R0725:Pcm1 UTSW 8 41287811 missense probably damaging 1.00
R0762:Pcm1 UTSW 8 41261020 missense probably damaging 1.00
R0848:Pcm1 UTSW 8 41282683 missense probably damaging 1.00
R1027:Pcm1 UTSW 8 41293445 splice site probably benign
R1056:Pcm1 UTSW 8 41321900 missense probably damaging 1.00
R1534:Pcm1 UTSW 8 41287701 missense probably benign
R1566:Pcm1 UTSW 8 41290773 missense probably damaging 1.00
R1595:Pcm1 UTSW 8 41309635 missense probably damaging 1.00
R1719:Pcm1 UTSW 8 41313359 missense possibly damaging 0.62
R1816:Pcm1 UTSW 8 41309537 missense probably damaging 0.99
R2177:Pcm1 UTSW 8 41275965 missense probably benign
R2495:Pcm1 UTSW 8 41293579 missense probably benign
R3737:Pcm1 UTSW 8 41261043 nonsense probably null
R3747:Pcm1 UTSW 8 41332004 missense probably benign 0.44
R3763:Pcm1 UTSW 8 41280077 missense probably damaging 1.00
R3764:Pcm1 UTSW 8 41330882 missense probably damaging 1.00
R3798:Pcm1 UTSW 8 41258014 missense possibly damaging 0.66
R3968:Pcm1 UTSW 8 41325830 missense probably damaging 1.00
R4760:Pcm1 UTSW 8 41287738 missense probably damaging 0.99
R4798:Pcm1 UTSW 8 41293678 missense probably damaging 1.00
R5062:Pcm1 UTSW 8 41259260 missense probably damaging 0.99
R5221:Pcm1 UTSW 8 41288156 critical splice donor site probably null
R5250:Pcm1 UTSW 8 41312205 missense probably damaging 0.99
R5466:Pcm1 UTSW 8 41272462 critical splice donor site probably null
R5470:Pcm1 UTSW 8 41287683 missense probably damaging 1.00
R5958:Pcm1 UTSW 8 41328979 missense probably damaging 1.00
R6043:Pcm1 UTSW 8 41328778 missense possibly damaging 0.54
R6179:Pcm1 UTSW 8 41283632 missense probably damaging 0.99
R6186:Pcm1 UTSW 8 41293793 missense probably benign 0.23
R6227:Pcm1 UTSW 8 41330825 missense probably damaging 0.99
R6368:Pcm1 UTSW 8 41293544 missense probably benign 0.09
R6438:Pcm1 UTSW 8 41325381 missense possibly damaging 0.94
R6459:Pcm1 UTSW 8 41261036 missense probably damaging 1.00
R7399:Pcm1 UTSW 8 41293510 missense probably benign 0.11
R7401:Pcm1 UTSW 8 41309531 missense probably damaging 1.00
R7478:Pcm1 UTSW 8 41261373 missense probably benign 0.17
R7570:Pcm1 UTSW 8 41267344 missense possibly damaging 0.64
R7648:Pcm1 UTSW 8 41275699 missense probably damaging 0.99
R7779:Pcm1 UTSW 8 41329024 missense probably damaging 1.00
R7842:Pcm1 UTSW 8 41327584 missense possibly damaging 0.54
R7863:Pcm1 UTSW 8 41261126 missense probably damaging 0.99
R8169:Pcm1 UTSW 8 41310116 missense possibly damaging 0.58
R8210:Pcm1 UTSW 8 41313937 missense probably damaging 1.00
R8303:Pcm1 UTSW 8 41283721 missense probably damaging 1.00
R8397:Pcm1 UTSW 8 41283579 missense probably damaging 1.00
X0025:Pcm1 UTSW 8 41330642 missense probably damaging 1.00
Z1177:Pcm1 UTSW 8 41274171 missense possibly damaging 0.94
Z1177:Pcm1 UTSW 8 41287744 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCATGAAGTACATACAGTTTTCC -3'
(R):5'- GGAGCTACCCATATAGAAGCAC -3'

Sequencing Primer
(F):5'- ATATAGTCCAAGCTGCTGGC -3'
(R):5'- CCCATATAGAAGCACTGAGTAAGCTG -3'
Posted On2019-11-26