Incidental Mutation 'R7774:Zfp418'
ID598763
Institutional Source Beutler Lab
Gene Symbol Zfp418
Ensembl Gene ENSMUSG00000034538
Gene Namezinc finger protein 418
SynonymsA230102I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7774 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location7171330-7183562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7182777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 580 (V580I)
Ref Sequence ENSEMBL: ENSMUSP00000057159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051435
AA Change: V580I

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057159
Gene: ENSMUSG00000034538
AA Change: V580I

DomainStartEndE-ValueType
KRAB 25 78 2.58e-17 SMART
low complexity region 196 211 N/A INTRINSIC
ZnF_C2H2 256 278 6.32e-3 SMART
ZnF_C2H2 284 306 2.57e-3 SMART
ZnF_C2H2 312 334 1.56e-2 SMART
ZnF_C2H2 340 362 1.36e-2 SMART
ZnF_C2H2 368 390 1.82e-3 SMART
ZnF_C2H2 396 418 1.04e-3 SMART
ZnF_C2H2 424 446 2.75e-3 SMART
ZnF_C2H2 452 474 4.47e-3 SMART
ZnF_C2H2 480 502 1.58e-3 SMART
ZnF_C2H2 508 530 8.6e-5 SMART
ZnF_C2H2 536 558 7.78e-3 SMART
ZnF_C2H2 564 586 1.5e-4 SMART
ZnF_C2H2 592 614 4.54e-4 SMART
ZnF_C2H2 620 642 5.59e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,596,533 T809N probably benign Het
Adgb C A 10: 10,339,660 E1561* probably null Het
Adgra1 A T 7: 139,847,712 H65L possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Atrnl1 G T 19: 57,699,671 G856V probably damaging Het
Cc2d2b A G 19: 40,765,717 K177E unknown Het
Ccdc122 T C 14: 77,067,939 V11A probably benign Het
Clasp2 T A 9: 113,848,736 probably null Het
Col6a1 T C 10: 76,709,876 T921A unknown Het
Cul3 A C 1: 80,269,294 D697E probably benign Het
Defa34 G A 8: 21,665,962 E56K probably benign Het
Dhrs7c A G 11: 67,809,815 R63G probably damaging Het
Dnah3 T A 7: 119,951,752 K136* probably null Het
Exoc7 T C 11: 116,295,316 D353G possibly damaging Het
Fbxw21 T C 9: 109,143,840 Y342C probably benign Het
Fitm2 T A 2: 163,470,066 I76F probably damaging Het
Fryl A T 5: 73,083,384 I1291N probably benign Het
Fzd2 A T 11: 102,605,488 I253F possibly damaging Het
Gm13089 C T 4: 143,697,106 S371N possibly damaging Het
Gm5592 A T 7: 41,289,859 Y855F probably damaging Het
Helz2 T C 2: 181,233,991 Y1570C probably benign Het
Hist1h1t A G 13: 23,696,200 K112R possibly damaging Het
Hist4h4 G T 6: 136,804,283 P33T possibly damaging Het
Ints11 A G 4: 155,885,683 T228A probably benign Het
Ipo13 G T 4: 117,914,297 N25K probably benign Het
Itga9 T A 9: 118,871,900 I917N probably damaging Het
Krt39 T C 11: 99,514,611 probably null Het
Krtap13-1 C T 16: 88,729,173 T95I possibly damaging Het
Ldlrad4 G T 18: 68,235,792 E107* probably null Het
Lrrc6 T G 15: 66,449,552 I247L probably benign Het
Ly6a A T 15: 74,997,567 I13N probably damaging Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Mgat3 C T 15: 80,211,542 T190M probably damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mucl1 G T 15: 103,753,684 N85K possibly damaging Het
Nifk G A 1: 118,327,661 E96K possibly damaging Het
Olfr290 T A 7: 84,916,531 F251I probably damaging Het
Olfr600 T C 7: 103,346,530 R133G possibly damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Opn3 C T 1: 175,662,905 V397M probably damaging Het
Pcdha2 A G 18: 36,941,526 M737V probably benign Het
Pdk4 T A 6: 5,492,757 D98V possibly damaging Het
Pkhd1l1 A G 15: 44,540,907 T2311A probably benign Het
Pla2r1 A T 2: 60,530,458 C195* probably null Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprq T C 10: 107,643,669 T1166A probably damaging Het
Ran G A 5: 129,022,810 D215N probably benign Het
Rb1cc1 T C 1: 6,248,085 F604L possibly damaging Het
Rgl1 T A 1: 152,554,350 E227D probably benign Het
Sec24b C A 3: 129,984,197 R1204L possibly damaging Het
Shroom3 T C 5: 92,950,489 L1276P probably damaging Het
Smarcad1 T A 6: 65,107,830 M820K probably damaging Het
Sptbn1 A T 11: 30,142,142 M541K probably damaging Het
Tcp11l2 T C 10: 84,604,983 V351A possibly damaging Het
Tecpr2 A G 12: 110,933,172 D658G probably benign Het
Tlr6 T G 5: 64,953,385 E726D probably damaging Het
Tmem218 T A 9: 37,222,568 H101Q probably benign Het
Tnfrsf4 C T 4: 156,014,338 Q82* probably null Het
Trpm7 A G 2: 126,813,238 V1260A probably benign Het
Trpm8 A T 1: 88,330,841 E282V probably damaging Het
Tuba8 T C 6: 121,223,389 V344A probably damaging Het
Tvp23a A G 16: 10,427,381 probably null Het
Zfp174 G A 16: 3,849,351 V135M probably damaging Het
Zfp451 T A 1: 33,805,393 E44D probably benign Het
Zfp521 T C 18: 13,845,781 D525G probably benign Het
Other mutations in Zfp418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Zfp418 APN 7 7181449 missense possibly damaging 0.72
IGL02351:Zfp418 APN 7 7174691 splice site probably benign
IGL02358:Zfp418 APN 7 7174691 splice site probably benign
P0029:Zfp418 UTSW 7 7174637 missense probably damaging 0.98
R0018:Zfp418 UTSW 7 7182450 missense probably benign 0.06
R0018:Zfp418 UTSW 7 7182450 missense probably benign 0.06
R1065:Zfp418 UTSW 7 7181562 missense probably benign 0.18
R1168:Zfp418 UTSW 7 7182501 missense possibly damaging 0.91
R1660:Zfp418 UTSW 7 7181790 missense probably benign 0.04
R1937:Zfp418 UTSW 7 7182402 missense possibly damaging 0.71
R2266:Zfp418 UTSW 7 7182808 missense probably benign 0.18
R3119:Zfp418 UTSW 7 7181689 missense possibly damaging 0.53
R4355:Zfp418 UTSW 7 7172162 missense probably benign 0.02
R4539:Zfp418 UTSW 7 7181277 missense probably benign 0.18
R4735:Zfp418 UTSW 7 7182562 missense probably damaging 0.96
R4756:Zfp418 UTSW 7 7182763 missense possibly damaging 0.89
R4763:Zfp418 UTSW 7 7181445 missense possibly damaging 0.53
R4810:Zfp418 UTSW 7 7182847 missense possibly damaging 0.82
R5347:Zfp418 UTSW 7 7182535 missense probably benign 0.40
R5592:Zfp418 UTSW 7 7181315 missense possibly damaging 0.72
R5640:Zfp418 UTSW 7 7181981 nonsense probably null
R5974:Zfp418 UTSW 7 7182200 missense possibly damaging 0.95
R6209:Zfp418 UTSW 7 7182097 missense possibly damaging 0.51
R6218:Zfp418 UTSW 7 7182628 missense possibly damaging 0.73
R6502:Zfp418 UTSW 7 7182600 missense possibly damaging 0.86
R6619:Zfp418 UTSW 7 7181896 missense probably damaging 0.98
R7205:Zfp418 UTSW 7 7181563 missense probably benign 0.33
R7299:Zfp418 UTSW 7 7182828 missense possibly damaging 0.61
R7492:Zfp418 UTSW 7 7181397 missense possibly damaging 0.53
R7826:Zfp418 UTSW 7 7182669 missense probably benign 0.32
R7974:Zfp418 UTSW 7 7182168 missense possibly damaging 0.61
R8002:Zfp418 UTSW 7 7181874 missense probably benign 0.04
R8182:Zfp418 UTSW 7 7181659 missense probably benign 0.00
R8298:Zfp418 UTSW 7 7182815 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTATGCTTTCGCCAGAGAG -3'
(R):5'- TGCTAGAGAGTTGTCTAGGCTTTCC -3'

Sequencing Primer
(F):5'- AGTGCGGGAAATCTTATACCC -3'
(R):5'- CCAGTGTGAAGTAGCTGATGCC -3'
Posted On2019-11-26