Incidental Mutation 'R7774:Olfr290'
ID598765
Institutional Source Beutler Lab
Gene Symbol Olfr290
Ensembl Gene ENSMUSG00000116179
Gene Name
SynonymsGA_x6K02T2NHDJ-11170115-11169168, MOR254-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R7774 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location84915781-84916728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84916531 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 251 (F251I)
Ref Sequence ENSEMBL: ENSMUSP00000149411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073468] [ENSMUST00000214501] [ENSMUST00000216184] [ENSMUST00000216367]
Predicted Effect probably damaging
Transcript: ENSMUST00000073468
AA Change: F251I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073172
Gene: ENSMUSG00000116179
AA Change: F251I

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 8.4e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.2e-10 PFAM
Pfam:7tm_1 41 291 1.3e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214501
AA Change: F251I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216184
AA Change: F251I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216367
AA Change: F251I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,596,533 T809N probably benign Het
Adgb C A 10: 10,339,660 E1561* probably null Het
Adgra1 A T 7: 139,847,712 H65L possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Atrnl1 G T 19: 57,699,671 G856V probably damaging Het
Cc2d2b A G 19: 40,765,717 K177E unknown Het
Ccdc122 T C 14: 77,067,939 V11A probably benign Het
Clasp2 T A 9: 113,848,736 probably null Het
Col6a1 T C 10: 76,709,876 T921A unknown Het
Cul3 A C 1: 80,269,294 D697E probably benign Het
Defa34 G A 8: 21,665,962 E56K probably benign Het
Dhrs7c A G 11: 67,809,815 R63G probably damaging Het
Dnah3 T A 7: 119,951,752 K136* probably null Het
Exoc7 T C 11: 116,295,316 D353G possibly damaging Het
Fbxw21 T C 9: 109,143,840 Y342C probably benign Het
Fitm2 T A 2: 163,470,066 I76F probably damaging Het
Fryl A T 5: 73,083,384 I1291N probably benign Het
Fzd2 A T 11: 102,605,488 I253F possibly damaging Het
Gm13089 C T 4: 143,697,106 S371N possibly damaging Het
Gm5592 A T 7: 41,289,859 Y855F probably damaging Het
Helz2 T C 2: 181,233,991 Y1570C probably benign Het
Hist1h1t A G 13: 23,696,200 K112R possibly damaging Het
Hist4h4 G T 6: 136,804,283 P33T possibly damaging Het
Ints11 A G 4: 155,885,683 T228A probably benign Het
Ipo13 G T 4: 117,914,297 N25K probably benign Het
Itga9 T A 9: 118,871,900 I917N probably damaging Het
Krt39 T C 11: 99,514,611 probably null Het
Krtap13-1 C T 16: 88,729,173 T95I possibly damaging Het
Ldlrad4 G T 18: 68,235,792 E107* probably null Het
Lrrc6 T G 15: 66,449,552 I247L probably benign Het
Ly6a A T 15: 74,997,567 I13N probably damaging Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Mgat3 C T 15: 80,211,542 T190M probably damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mucl1 G T 15: 103,753,684 N85K possibly damaging Het
Nifk G A 1: 118,327,661 E96K possibly damaging Het
Olfr600 T C 7: 103,346,530 R133G possibly damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Opn3 C T 1: 175,662,905 V397M probably damaging Het
Pcdha2 A G 18: 36,941,526 M737V probably benign Het
Pdk4 T A 6: 5,492,757 D98V possibly damaging Het
Pkhd1l1 A G 15: 44,540,907 T2311A probably benign Het
Pla2r1 A T 2: 60,530,458 C195* probably null Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprq T C 10: 107,643,669 T1166A probably damaging Het
Ran G A 5: 129,022,810 D215N probably benign Het
Rb1cc1 T C 1: 6,248,085 F604L possibly damaging Het
Rgl1 T A 1: 152,554,350 E227D probably benign Het
Sec24b C A 3: 129,984,197 R1204L possibly damaging Het
Shroom3 T C 5: 92,950,489 L1276P probably damaging Het
Smarcad1 T A 6: 65,107,830 M820K probably damaging Het
Sptbn1 A T 11: 30,142,142 M541K probably damaging Het
Tcp11l2 T C 10: 84,604,983 V351A possibly damaging Het
Tecpr2 A G 12: 110,933,172 D658G probably benign Het
Tlr6 T G 5: 64,953,385 E726D probably damaging Het
Tmem218 T A 9: 37,222,568 H101Q probably benign Het
Tnfrsf4 C T 4: 156,014,338 Q82* probably null Het
Trpm7 A G 2: 126,813,238 V1260A probably benign Het
Trpm8 A T 1: 88,330,841 E282V probably damaging Het
Tuba8 T C 6: 121,223,389 V344A probably damaging Het
Tvp23a A G 16: 10,427,381 probably null Het
Zfp174 G A 16: 3,849,351 V135M probably damaging Het
Zfp418 G A 7: 7,182,777 V580I possibly damaging Het
Zfp451 T A 1: 33,805,393 E44D probably benign Het
Zfp521 T C 18: 13,845,781 D525G probably benign Het
Other mutations in Olfr290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr290 APN 7 84916370 missense probably damaging 0.99
IGL01322:Olfr290 APN 7 84916382 missense probably damaging 0.99
IGL01834:Olfr290 APN 7 84916652 missense probably damaging 1.00
IGL02556:Olfr290 APN 7 84916359 nonsense probably null
IGL03246:Olfr290 APN 7 84916711 missense probably benign 0.03
IGL03255:Olfr290 APN 7 84916517 missense possibly damaging 0.95
R0322:Olfr290 UTSW 7 84916313 missense probably damaging 1.00
R1253:Olfr290 UTSW 7 84916709 missense probably benign
R1652:Olfr290 UTSW 7 84916520 missense probably damaging 1.00
R1673:Olfr290 UTSW 7 84916117 missense probably damaging 0.97
R1891:Olfr290 UTSW 7 84916253 missense possibly damaging 0.93
R1895:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R1946:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R2128:Olfr290 UTSW 7 84916493 missense probably damaging 1.00
R4435:Olfr290 UTSW 7 84916021 missense probably benign 0.45
R4822:Olfr290 UTSW 7 84916426 missense possibly damaging 0.81
R4834:Olfr290 UTSW 7 84916283 missense probably damaging 1.00
R5354:Olfr290 UTSW 7 84916149 nonsense probably null
R5644:Olfr290 UTSW 7 84916119 missense probably benign 0.15
R5650:Olfr290 UTSW 7 84916418 missense possibly damaging 0.50
R5708:Olfr290 UTSW 7 84916183 missense possibly damaging 0.56
R6585:Olfr290 UTSW 7 84916462 missense probably damaging 0.99
R8126:Olfr290 UTSW 7 84915906 missense probably damaging 1.00
R8443:Olfr290 UTSW 7 84916579 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCATCTACCTATATGGCAGAAATGC -3'
(R):5'- AGCTTGAGAAGTCTTGCATCATTC -3'

Sequencing Primer
(F):5'- GCAGAAATGCTTGTTTTAGTGATAG -3'
(R):5'- CTCTCTGTGAACATATCCGAAGATG -3'
Posted On2019-11-26