Incidental Mutation 'R7774:Adprhl1'
ID598770
Institutional Source Beutler Lab
Gene Symbol Adprhl1
Ensembl Gene ENSMUSG00000031448
Gene NameADP-ribosylhydrolase like 1
SynonymsArh2, D330008N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7774 (G1)
Quality Score216.009
Status Validated
Chromosome8
Chromosomal Location13221663-13254162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13248682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 83 (V83I)
Ref Sequence ENSEMBL: ENSMUSP00000033825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]
Predicted Effect probably damaging
Transcript: ENSMUST00000033825
AA Change: V83I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: V83I

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 1.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168498
SMART Domains Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 69 196 9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171619
AA Change: V2I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448
AA Change: V2I

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 1 135 4.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204916
AA Change: V83I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: V83I

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 4.2e-49 PFAM
low complexity region 509 527 N/A INTRINSIC
low complexity region 955 969 N/A INTRINSIC
internal_repeat_1 1047 1150 1.82e-5 PROSPERO
internal_repeat_1 1157 1274 1.82e-5 PROSPERO
low complexity region 1275 1290 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,596,533 T809N probably benign Het
Adgb C A 10: 10,339,660 E1561* probably null Het
Adgra1 A T 7: 139,847,712 H65L possibly damaging Het
Atrnl1 G T 19: 57,699,671 G856V probably damaging Het
Cc2d2b A G 19: 40,765,717 K177E unknown Het
Ccdc122 T C 14: 77,067,939 V11A probably benign Het
Clasp2 T A 9: 113,848,736 probably null Het
Col6a1 T C 10: 76,709,876 T921A unknown Het
Cul3 A C 1: 80,269,294 D697E probably benign Het
Defa34 G A 8: 21,665,962 E56K probably benign Het
Dhrs7c A G 11: 67,809,815 R63G probably damaging Het
Dnah3 T A 7: 119,951,752 K136* probably null Het
Exoc7 T C 11: 116,295,316 D353G possibly damaging Het
Fbxw21 T C 9: 109,143,840 Y342C probably benign Het
Fitm2 T A 2: 163,470,066 I76F probably damaging Het
Fryl A T 5: 73,083,384 I1291N probably benign Het
Fzd2 A T 11: 102,605,488 I253F possibly damaging Het
Gm13089 C T 4: 143,697,106 S371N possibly damaging Het
Gm5592 A T 7: 41,289,859 Y855F probably damaging Het
Helz2 T C 2: 181,233,991 Y1570C probably benign Het
Hist1h1t A G 13: 23,696,200 K112R possibly damaging Het
Hist4h4 G T 6: 136,804,283 P33T possibly damaging Het
Ints11 A G 4: 155,885,683 T228A probably benign Het
Ipo13 G T 4: 117,914,297 N25K probably benign Het
Itga9 T A 9: 118,871,900 I917N probably damaging Het
Krt39 T C 11: 99,514,611 probably null Het
Krtap13-1 C T 16: 88,729,173 T95I possibly damaging Het
Ldlrad4 G T 18: 68,235,792 E107* probably null Het
Lrrc6 T G 15: 66,449,552 I247L probably benign Het
Ly6a A T 15: 74,997,567 I13N probably damaging Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Mgat3 C T 15: 80,211,542 T190M probably damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mucl1 G T 15: 103,753,684 N85K possibly damaging Het
Nifk G A 1: 118,327,661 E96K possibly damaging Het
Olfr290 T A 7: 84,916,531 F251I probably damaging Het
Olfr600 T C 7: 103,346,530 R133G possibly damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Opn3 C T 1: 175,662,905 V397M probably damaging Het
Pcdha2 A G 18: 36,941,526 M737V probably benign Het
Pdk4 T A 6: 5,492,757 D98V possibly damaging Het
Pkhd1l1 A G 15: 44,540,907 T2311A probably benign Het
Pla2r1 A T 2: 60,530,458 C195* probably null Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprq T C 10: 107,643,669 T1166A probably damaging Het
Ran G A 5: 129,022,810 D215N probably benign Het
Rb1cc1 T C 1: 6,248,085 F604L possibly damaging Het
Rgl1 T A 1: 152,554,350 E227D probably benign Het
Sec24b C A 3: 129,984,197 R1204L possibly damaging Het
Shroom3 T C 5: 92,950,489 L1276P probably damaging Het
Smarcad1 T A 6: 65,107,830 M820K probably damaging Het
Sptbn1 A T 11: 30,142,142 M541K probably damaging Het
Tcp11l2 T C 10: 84,604,983 V351A possibly damaging Het
Tecpr2 A G 12: 110,933,172 D658G probably benign Het
Tlr6 T G 5: 64,953,385 E726D probably damaging Het
Tmem218 T A 9: 37,222,568 H101Q probably benign Het
Tnfrsf4 C T 4: 156,014,338 Q82* probably null Het
Trpm7 A G 2: 126,813,238 V1260A probably benign Het
Trpm8 A T 1: 88,330,841 E282V probably damaging Het
Tuba8 T C 6: 121,223,389 V344A probably damaging Het
Tvp23a A G 16: 10,427,381 probably null Het
Zfp174 G A 16: 3,849,351 V135M probably damaging Het
Zfp418 G A 7: 7,182,777 V580I possibly damaging Het
Zfp451 T A 1: 33,805,393 E44D probably benign Het
Zfp521 T C 18: 13,845,781 D525G probably benign Het
Other mutations in Adprhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Adprhl1 APN 8 13246170 splice site probably benign
BB003:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB004:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB005:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB006:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB013:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB014:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB015:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
BB016:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R0244:Adprhl1 UTSW 8 13242391 splice site probably benign
R0636:Adprhl1 UTSW 8 13248702 missense probably damaging 1.00
R1295:Adprhl1 UTSW 8 13248624 missense probably damaging 1.00
R2111:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2112:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2184:Adprhl1 UTSW 8 13242559 missense probably benign 0.00
R4411:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4412:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4413:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4615:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R4618:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R5016:Adprhl1 UTSW 8 13224889 missense possibly damaging 0.88
R5058:Adprhl1 UTSW 8 13242625 missense probably damaging 1.00
R5060:Adprhl1 UTSW 8 13248621 missense possibly damaging 0.63
R5209:Adprhl1 UTSW 8 13242563 nonsense probably null
R6103:Adprhl1 UTSW 8 13222055 missense possibly damaging 0.91
R6158:Adprhl1 UTSW 8 13224977 missense possibly damaging 0.93
R6221:Adprhl1 UTSW 8 13225634 missense probably benign 0.01
R6971:Adprhl1 UTSW 8 13223476 missense probably benign
R7087:Adprhl1 UTSW 8 13221856 missense probably damaging 0.99
R7362:Adprhl1 UTSW 8 13245534 missense probably damaging 1.00
R7404:Adprhl1 UTSW 8 13225118 missense probably damaging 0.99
R7422:Adprhl1 UTSW 8 13222873 missense probably benign 0.28
R7439:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7441:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7772:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7773:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7776:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7876:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7877:Adprhl1 UTSW 8 13225316 nonsense probably null
R7926:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7927:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7928:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7929:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7944:Adprhl1 UTSW 8 13221929 missense probably damaging 0.99
R7945:Adprhl1 UTSW 8 13221929 missense probably damaging 0.99
R7946:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7947:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7949:Adprhl1 UTSW 8 13224225 missense possibly damaging 0.93
R8155:Adprhl1 UTSW 8 13221764 missense probably damaging 0.99
R8182:Adprhl1 UTSW 8 13222774 missense probably benign 0.07
Z1176:Adprhl1 UTSW 8 13225613 missense probably benign 0.01
Z1177:Adprhl1 UTSW 8 13245476 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ATACCACACCAAGTGTCGGG -3'
(R):5'- TGGTGGATGTTCCCTAGACC -3'

Sequencing Primer
(F):5'- TTCACACGCACAGGGTC -3'
(R):5'- TGGATGTTCCCTAGACCCTCGG -3'
Posted On2019-11-26