Incidental Mutation 'R7774:Adgb'
ID 598776
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Name androglobin
Synonyms 9130014G24Rik
MMRRC Submission 045830-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7774 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 10211447-10348070 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 10215404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1561 (E1561*)
Ref Sequence ENSEMBL: ENSMUSP00000136386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
AlphaFold G3UZ78
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000172530
AA Change: E1558*
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: E1558*

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179956
AA Change: E1561*
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: E1561*

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208717
AA Change: E1534*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,494,414 (GRCm39) T809N probably benign Het
Adgra1 A T 7: 139,427,628 (GRCm39) H65L possibly damaging Het
Adprhl1 C T 8: 13,298,682 (GRCm39) V83I probably damaging Het
Atrnl1 G T 19: 57,688,103 (GRCm39) G856V probably damaging Het
Cc2d2b A G 19: 40,754,161 (GRCm39) K177E unknown Het
Ccdc122 T C 14: 77,305,379 (GRCm39) V11A probably benign Het
Clasp2 T A 9: 113,677,804 (GRCm39) probably null Het
Col6a1 T C 10: 76,545,710 (GRCm39) T921A unknown Het
Cul3 A C 1: 80,247,011 (GRCm39) D697E probably benign Het
Defa34 G A 8: 22,155,978 (GRCm39) E56K probably benign Het
Dhrs7c A G 11: 67,700,641 (GRCm39) R63G probably damaging Het
Dnaaf11 T G 15: 66,321,401 (GRCm39) I247L probably benign Het
Dnah3 T A 7: 119,550,975 (GRCm39) K136* probably null Het
Exoc7 T C 11: 116,186,142 (GRCm39) D353G possibly damaging Het
Fbxw21 T C 9: 108,972,908 (GRCm39) Y342C probably benign Het
Fitm2 T A 2: 163,311,986 (GRCm39) I76F probably damaging Het
Fryl A T 5: 73,240,727 (GRCm39) I1291N probably benign Het
Fzd2 A T 11: 102,496,314 (GRCm39) I253F possibly damaging Het
Gm5592 A T 7: 40,939,283 (GRCm39) Y855F probably damaging Het
H1f6 A G 13: 23,880,183 (GRCm39) K112R possibly damaging Het
H4c16 G T 6: 136,781,281 (GRCm39) P33T possibly damaging Het
Helz2 T C 2: 180,875,784 (GRCm39) Y1570C probably benign Het
Ints11 A G 4: 155,970,140 (GRCm39) T228A probably benign Het
Ipo13 G T 4: 117,771,494 (GRCm39) N25K probably benign Het
Itga9 T A 9: 118,700,968 (GRCm39) I917N probably damaging Het
Krt39 T C 11: 99,405,437 (GRCm39) probably null Het
Krtap13-1 C T 16: 88,526,061 (GRCm39) T95I possibly damaging Het
Ldlrad4 G T 18: 68,368,863 (GRCm39) E107* probably null Het
Ly6a A T 15: 74,869,416 (GRCm39) I13N probably damaging Het
Mfsd4b4 T C 10: 39,768,407 (GRCm39) T275A probably benign Het
Mgat3 C T 15: 80,095,743 (GRCm39) T190M probably damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mucl1 G T 15: 103,783,950 (GRCm39) N85K possibly damaging Het
Nifk G A 1: 118,255,391 (GRCm39) E96K possibly damaging Het
Opn3 C T 1: 175,490,471 (GRCm39) V397M probably damaging Het
Or52ad1 T C 7: 102,995,737 (GRCm39) R133G possibly damaging Het
Or5ae1 T A 7: 84,565,739 (GRCm39) F251I probably damaging Het
Or8c17 T C 9: 38,180,655 (GRCm39) V274A probably damaging Het
Pcdha2 A G 18: 37,074,579 (GRCm39) M737V probably benign Het
Pdk4 T A 6: 5,492,757 (GRCm39) D98V possibly damaging Het
Pkhd1l1 A G 15: 44,404,303 (GRCm39) T2311A probably benign Het
Pla2r1 A T 2: 60,360,802 (GRCm39) C195* probably null Het
Polr1b C A 2: 128,967,464 (GRCm39) F952L probably damaging Het
Pramel23 C T 4: 143,423,676 (GRCm39) S371N possibly damaging Het
Ptprq T C 10: 107,479,530 (GRCm39) T1166A probably damaging Het
Ran G A 5: 129,099,874 (GRCm39) D215N probably benign Het
Rb1cc1 T C 1: 6,318,309 (GRCm39) F604L possibly damaging Het
Rgl1 T A 1: 152,430,101 (GRCm39) E227D probably benign Het
Sec24b C A 3: 129,777,846 (GRCm39) R1204L possibly damaging Het
Shroom3 T C 5: 93,098,348 (GRCm39) L1276P probably damaging Het
Smarcad1 T A 6: 65,084,814 (GRCm39) M820K probably damaging Het
Sptbn1 A T 11: 30,092,142 (GRCm39) M541K probably damaging Het
Tcp11l2 T C 10: 84,440,847 (GRCm39) V351A possibly damaging Het
Tecpr2 A G 12: 110,899,606 (GRCm39) D658G probably benign Het
Tlr6 T G 5: 65,110,728 (GRCm39) E726D probably damaging Het
Tmem218 T A 9: 37,133,864 (GRCm39) H101Q probably benign Het
Tnfrsf4 C T 4: 156,098,795 (GRCm39) Q82* probably null Het
Trpm7 A G 2: 126,655,158 (GRCm39) V1260A probably benign Het
Trpm8 A T 1: 88,258,563 (GRCm39) E282V probably damaging Het
Tuba8 T C 6: 121,200,348 (GRCm39) V344A probably damaging Het
Tvp23a A G 16: 10,245,245 (GRCm39) probably null Het
Zfp174 G A 16: 3,667,215 (GRCm39) V135M probably damaging Het
Zfp418 G A 7: 7,185,776 (GRCm39) V580I possibly damaging Het
Zfp451 T A 1: 33,844,474 (GRCm39) E44D probably benign Het
Zfp521 T C 18: 13,978,838 (GRCm39) D525G probably benign Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10,281,843 (GRCm39) missense possibly damaging 0.87
IGL01083:Adgb APN 10 10,283,298 (GRCm39) missense possibly damaging 0.50
IGL03064:Adgb APN 10 10,276,316 (GRCm39) missense probably benign 0.02
R0080:Adgb UTSW 10 10,253,583 (GRCm39) splice site probably benign
R0084:Adgb UTSW 10 10,272,088 (GRCm39) missense possibly damaging 0.74
R0112:Adgb UTSW 10 10,282,902 (GRCm39) splice site probably benign
R0348:Adgb UTSW 10 10,233,623 (GRCm39) missense probably benign
R0415:Adgb UTSW 10 10,306,811 (GRCm39) splice site probably null
R0633:Adgb UTSW 10 10,267,473 (GRCm39) missense probably benign 0.36
R1052:Adgb UTSW 10 10,318,357 (GRCm39) missense probably benign 0.29
R1248:Adgb UTSW 10 10,271,054 (GRCm39) missense probably damaging 0.98
R1278:Adgb UTSW 10 10,258,572 (GRCm39) missense probably damaging 1.00
R1568:Adgb UTSW 10 10,318,409 (GRCm39) nonsense probably null
R1647:Adgb UTSW 10 10,271,115 (GRCm39) missense probably damaging 1.00
R1648:Adgb UTSW 10 10,271,115 (GRCm39) missense probably damaging 1.00
R1663:Adgb UTSW 10 10,215,419 (GRCm39) missense possibly damaging 0.86
R1688:Adgb UTSW 10 10,226,061 (GRCm39) nonsense probably null
R1758:Adgb UTSW 10 10,302,349 (GRCm39) missense probably damaging 1.00
R1772:Adgb UTSW 10 10,258,465 (GRCm39) splice site probably benign
R1850:Adgb UTSW 10 10,318,246 (GRCm39) missense probably damaging 1.00
R1959:Adgb UTSW 10 10,270,993 (GRCm39) missense probably benign 0.02
R1980:Adgb UTSW 10 10,309,242 (GRCm39) missense probably benign
R2179:Adgb UTSW 10 10,271,018 (GRCm39) missense possibly damaging 0.94
R2229:Adgb UTSW 10 10,311,795 (GRCm39) missense probably damaging 1.00
R2283:Adgb UTSW 10 10,253,635 (GRCm39) missense probably damaging 0.99
R2870:Adgb UTSW 10 10,307,025 (GRCm39) critical splice donor site probably null
R2870:Adgb UTSW 10 10,307,025 (GRCm39) critical splice donor site probably null
R2875:Adgb UTSW 10 10,298,463 (GRCm39) missense probably damaging 1.00
R2876:Adgb UTSW 10 10,298,463 (GRCm39) missense probably damaging 1.00
R2920:Adgb UTSW 10 10,265,987 (GRCm39) missense probably damaging 1.00
R2931:Adgb UTSW 10 10,318,246 (GRCm39) missense possibly damaging 0.84
R3722:Adgb UTSW 10 10,216,254 (GRCm39) missense probably benign 0.32
R3846:Adgb UTSW 10 10,258,465 (GRCm39) splice site probably benign
R3877:Adgb UTSW 10 10,318,227 (GRCm39) critical splice donor site probably null
R4210:Adgb UTSW 10 10,283,209 (GRCm39) missense probably benign 0.06
R4211:Adgb UTSW 10 10,283,209 (GRCm39) missense probably benign 0.06
R4333:Adgb UTSW 10 10,318,246 (GRCm39) missense possibly damaging 0.84
R4448:Adgb UTSW 10 10,266,569 (GRCm39) missense probably benign 0.32
R4470:Adgb UTSW 10 10,274,695 (GRCm39) missense probably benign 0.02
R4624:Adgb UTSW 10 10,278,748 (GRCm39) missense probably benign 0.00
R4656:Adgb UTSW 10 10,281,050 (GRCm39) missense probably damaging 0.99
R4676:Adgb UTSW 10 10,302,454 (GRCm39) missense probably damaging 1.00
R4792:Adgb UTSW 10 10,274,647 (GRCm39) missense probably damaging 0.96
R4795:Adgb UTSW 10 10,233,616 (GRCm39) missense probably benign 0.01
R4858:Adgb UTSW 10 10,225,321 (GRCm39) missense probably damaging 1.00
R4985:Adgb UTSW 10 10,276,376 (GRCm39) missense possibly damaging 0.69
R5057:Adgb UTSW 10 10,233,722 (GRCm39) missense probably benign 0.11
R5157:Adgb UTSW 10 10,274,710 (GRCm39) missense probably damaging 1.00
R5209:Adgb UTSW 10 10,274,681 (GRCm39) missense possibly damaging 0.71
R5339:Adgb UTSW 10 10,318,350 (GRCm39) missense probably damaging 1.00
R5376:Adgb UTSW 10 10,222,307 (GRCm39) missense probably benign 0.09
R5426:Adgb UTSW 10 10,226,004 (GRCm39) missense probably benign 0.14
R5516:Adgb UTSW 10 10,306,901 (GRCm39) missense probably damaging 1.00
R5554:Adgb UTSW 10 10,216,217 (GRCm39) missense probably damaging 0.98
R5678:Adgb UTSW 10 10,307,070 (GRCm39) missense possibly damaging 0.83
R5707:Adgb UTSW 10 10,267,501 (GRCm39) missense probably damaging 1.00
R5708:Adgb UTSW 10 10,267,501 (GRCm39) missense probably damaging 1.00
R5891:Adgb UTSW 10 10,253,591 (GRCm39) nonsense probably null
R5928:Adgb UTSW 10 10,254,531 (GRCm39) missense probably damaging 1.00
R6005:Adgb UTSW 10 10,271,096 (GRCm39) missense probably damaging 1.00
R6017:Adgb UTSW 10 10,325,780 (GRCm39) missense probably damaging 1.00
R6049:Adgb UTSW 10 10,253,770 (GRCm39) missense probably damaging 1.00
R6118:Adgb UTSW 10 10,307,035 (GRCm39) missense probably damaging 1.00
R6175:Adgb UTSW 10 10,274,687 (GRCm39) missense possibly damaging 0.94
R6186:Adgb UTSW 10 10,298,502 (GRCm39) missense probably damaging 1.00
R6234:Adgb UTSW 10 10,228,824 (GRCm39) splice site probably null
R6383:Adgb UTSW 10 10,325,772 (GRCm39) missense probably damaging 1.00
R6522:Adgb UTSW 10 10,253,636 (GRCm39) nonsense probably null
R6639:Adgb UTSW 10 10,311,700 (GRCm39) missense possibly damaging 0.51
R6697:Adgb UTSW 10 10,281,870 (GRCm39) nonsense probably null
R6742:Adgb UTSW 10 10,287,593 (GRCm39) missense probably damaging 1.00
R6745:Adgb UTSW 10 10,265,941 (GRCm39) missense probably damaging 1.00
R6850:Adgb UTSW 10 10,270,318 (GRCm39) missense probably benign 0.39
R7128:Adgb UTSW 10 10,347,985 (GRCm39) missense probably benign 0.26
R7326:Adgb UTSW 10 10,276,318 (GRCm39) missense possibly damaging 0.80
R7386:Adgb UTSW 10 10,253,693 (GRCm39) missense possibly damaging 0.52
R7431:Adgb UTSW 10 10,267,699 (GRCm39) splice site probably null
R7569:Adgb UTSW 10 10,306,996 (GRCm39) missense probably benign
R7579:Adgb UTSW 10 10,286,562 (GRCm39) nonsense probably null
R7582:Adgb UTSW 10 10,266,565 (GRCm39) missense probably damaging 1.00
R7615:Adgb UTSW 10 10,311,754 (GRCm39) missense probably damaging 0.96
R7692:Adgb UTSW 10 10,287,456 (GRCm39) critical splice donor site probably null
R7808:Adgb UTSW 10 10,254,403 (GRCm39) splice site probably null
R8158:Adgb UTSW 10 10,254,478 (GRCm39) missense probably benign 0.22
R8386:Adgb UTSW 10 10,226,048 (GRCm39) missense probably damaging 1.00
R8746:Adgb UTSW 10 10,281,028 (GRCm39) critical splice donor site probably null
R8785:Adgb UTSW 10 10,233,710 (GRCm39) missense probably damaging 1.00
R9089:Adgb UTSW 10 10,318,432 (GRCm39) missense probably benign 0.26
R9140:Adgb UTSW 10 10,216,263 (GRCm39) nonsense probably null
R9386:Adgb UTSW 10 10,274,708 (GRCm39) missense probably benign 0.00
R9777:Adgb UTSW 10 10,283,214 (GRCm39) missense possibly damaging 0.74
X0003:Adgb UTSW 10 10,270,374 (GRCm39) missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10,254,486 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTCAGATGAGTGAGTCTGC -3'
(R):5'- CGTCAGGTTTGGTTTGACTCAC -3'

Sequencing Primer
(F):5'- CAGATGAGTGAGTCTGCTTTCG -3'
(R):5'- GGTTTGGTTTGACTCACTATTAACAC -3'
Posted On 2019-11-26