Incidental Mutation 'R7774:Col6a1'
ID598778
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Namecollagen, type VI, alpha 1
SynonymsCol6a-1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R7774 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76708792-76726168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76709876 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 921 (T921A)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
Predicted Effect unknown
Transcript: ENSMUST00000001147
AA Change: T921A
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: T921A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,596,533 T809N probably benign Het
Adgb C A 10: 10,339,660 E1561* probably null Het
Adgra1 A T 7: 139,847,712 H65L possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Atrnl1 G T 19: 57,699,671 G856V probably damaging Het
Cc2d2b A G 19: 40,765,717 K177E unknown Het
Ccdc122 T C 14: 77,067,939 V11A probably benign Het
Clasp2 T A 9: 113,848,736 probably null Het
Cul3 A C 1: 80,269,294 D697E probably benign Het
Defa34 G A 8: 21,665,962 E56K probably benign Het
Dhrs7c A G 11: 67,809,815 R63G probably damaging Het
Dnah3 T A 7: 119,951,752 K136* probably null Het
Exoc7 T C 11: 116,295,316 D353G possibly damaging Het
Fbxw21 T C 9: 109,143,840 Y342C probably benign Het
Fitm2 T A 2: 163,470,066 I76F probably damaging Het
Fryl A T 5: 73,083,384 I1291N probably benign Het
Fzd2 A T 11: 102,605,488 I253F possibly damaging Het
Gm13089 C T 4: 143,697,106 S371N possibly damaging Het
Gm5592 A T 7: 41,289,859 Y855F probably damaging Het
Helz2 T C 2: 181,233,991 Y1570C probably benign Het
Hist1h1t A G 13: 23,696,200 K112R possibly damaging Het
Hist4h4 G T 6: 136,804,283 P33T possibly damaging Het
Ints11 A G 4: 155,885,683 T228A probably benign Het
Ipo13 G T 4: 117,914,297 N25K probably benign Het
Itga9 T A 9: 118,871,900 I917N probably damaging Het
Krt39 T C 11: 99,514,611 probably null Het
Krtap13-1 C T 16: 88,729,173 T95I possibly damaging Het
Ldlrad4 G T 18: 68,235,792 E107* probably null Het
Lrrc6 T G 15: 66,449,552 I247L probably benign Het
Ly6a A T 15: 74,997,567 I13N probably damaging Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Mgat3 C T 15: 80,211,542 T190M probably damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mucl1 G T 15: 103,753,684 N85K possibly damaging Het
Nifk G A 1: 118,327,661 E96K possibly damaging Het
Olfr290 T A 7: 84,916,531 F251I probably damaging Het
Olfr600 T C 7: 103,346,530 R133G possibly damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Opn3 C T 1: 175,662,905 V397M probably damaging Het
Pcdha2 A G 18: 36,941,526 M737V probably benign Het
Pdk4 T A 6: 5,492,757 D98V possibly damaging Het
Pkhd1l1 A G 15: 44,540,907 T2311A probably benign Het
Pla2r1 A T 2: 60,530,458 C195* probably null Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprq T C 10: 107,643,669 T1166A probably damaging Het
Ran G A 5: 129,022,810 D215N probably benign Het
Rb1cc1 T C 1: 6,248,085 F604L possibly damaging Het
Rgl1 T A 1: 152,554,350 E227D probably benign Het
Sec24b C A 3: 129,984,197 R1204L possibly damaging Het
Shroom3 T C 5: 92,950,489 L1276P probably damaging Het
Smarcad1 T A 6: 65,107,830 M820K probably damaging Het
Sptbn1 A T 11: 30,142,142 M541K probably damaging Het
Tcp11l2 T C 10: 84,604,983 V351A possibly damaging Het
Tecpr2 A G 12: 110,933,172 D658G probably benign Het
Tlr6 T G 5: 64,953,385 E726D probably damaging Het
Tmem218 T A 9: 37,222,568 H101Q probably benign Het
Tnfrsf4 C T 4: 156,014,338 Q82* probably null Het
Trpm7 A G 2: 126,813,238 V1260A probably benign Het
Trpm8 A T 1: 88,330,841 E282V probably damaging Het
Tuba8 T C 6: 121,223,389 V344A probably damaging Het
Tvp23a A G 16: 10,427,381 probably null Het
Zfp174 G A 16: 3,849,351 V135M probably damaging Het
Zfp418 G A 7: 7,182,777 V580I possibly damaging Het
Zfp451 T A 1: 33,805,393 E44D probably benign Het
Zfp521 T C 18: 13,845,781 D525G probably benign Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76710979 missense unknown
IGL01943:Col6a1 APN 10 76719123 critical splice donor site probably null
IGL02178:Col6a1 APN 10 76711075 missense unknown
IGL02928:Col6a1 APN 10 76709666 missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76718051 splice site probably benign
P0005:Col6a1 UTSW 10 76717329 splice site probably benign
R0398:Col6a1 UTSW 10 76710118 missense unknown
R0631:Col6a1 UTSW 10 76709735 missense probably benign 0.03
R0698:Col6a1 UTSW 10 76716280 missense unknown
R0699:Col6a1 UTSW 10 76716280 missense unknown
R0848:Col6a1 UTSW 10 76713624 critical splice donor site probably null
R1053:Col6a1 UTSW 10 76720966 missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76712324 missense unknown
R1480:Col6a1 UTSW 10 76709918 missense unknown
R1854:Col6a1 UTSW 10 76721949 missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76721956 missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76709596 missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76721498 missense probably benign 0.10
R2411:Col6a1 UTSW 10 76711088 missense unknown
R3236:Col6a1 UTSW 10 76711320 missense unknown
R3417:Col6a1 UTSW 10 76712369 missense unknown
R3832:Col6a1 UTSW 10 76711117 missense unknown
R3843:Col6a1 UTSW 10 76711341 missense unknown
R3903:Col6a1 UTSW 10 76711341 missense unknown
R3904:Col6a1 UTSW 10 76711341 missense unknown
R4409:Col6a1 UTSW 10 76721500 missense probably benign 0.17
R4418:Col6a1 UTSW 10 76718405 nonsense probably null
R4568:Col6a1 UTSW 10 76719197 intron probably benign
R4579:Col6a1 UTSW 10 76711357 missense unknown
R4661:Col6a1 UTSW 10 76714672 missense unknown
R4945:Col6a1 UTSW 10 76712272 missense unknown
R4958:Col6a1 UTSW 10 76723505 missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76709906 missense unknown
R5440:Col6a1 UTSW 10 76723454 missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76718371 critical splice donor site probably null
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6366:Col6a1 UTSW 10 76710970 missense unknown
R6435:Col6a1 UTSW 10 76711123 missense unknown
R6718:Col6a1 UTSW 10 76725050 missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76721443 missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76725009 missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76710341 splice site probably null
R7183:Col6a1 UTSW 10 76716259 critical splice donor site probably null
R7244:Col6a1 UTSW 10 76717408 nonsense probably null
R7625:Col6a1 UTSW 10 76713926 missense unknown
R7741:Col6a1 UTSW 10 76709909 missense unknown
R7834:Col6a1 UTSW 10 76709928 missense unknown
R8145:Col6a1 UTSW 10 76723471 missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76725029 missense probably damaging 1.00
RF019:Col6a1 UTSW 10 76711615 missense unknown
X0010:Col6a1 UTSW 10 76723538 missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76709975 missense unknown
Z1088:Col6a1 UTSW 10 76709559 makesense probably null
Predicted Primers PCR Primer
(F):5'- CGTCGTACTCTGCAGTCTTG -3'
(R):5'- AGCTGAGCGATTCCTGTCAG -3'

Sequencing Primer
(F):5'- AGTCTTGCCAGTGACAAGC -3'
(R):5'- AGGCAGGGCGGATCCTTC -3'
Posted On2019-11-26