Incidental Mutation 'R7774:Fzd2'
ID598783
Institutional Source Beutler Lab
Gene Symbol Fzd2
Ensembl Gene ENSMUSG00000050288
Gene Namefrizzled class receptor 2
SynonymsMfz10a, Fz10, Mfz10
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R7774 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102604396-102608058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102605488 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 253 (I253F)
Ref Sequence ENSEMBL: ENSMUSP00000091463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057893
AA Change: I253F

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091463
Gene: ENSMUSG00000050288
AA Change: I253F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 43 160 7.47e-74 SMART
low complexity region 176 195 N/A INTRINSIC
Frizzled 239 563 3.32e-218 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
PHENOTYPE: About 50% of mice homozygous for a reporter allele display a cleft palate and die as neonates; the remaining 50% survive exhibiting a variable degree of postnatal runting and reduced olfactory sensitivity to various odorants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,596,533 T809N probably benign Het
Adgb C A 10: 10,339,660 E1561* probably null Het
Adgra1 A T 7: 139,847,712 H65L possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Atrnl1 G T 19: 57,699,671 G856V probably damaging Het
Cc2d2b A G 19: 40,765,717 K177E unknown Het
Ccdc122 T C 14: 77,067,939 V11A probably benign Het
Col6a1 T C 10: 76,709,876 T921A unknown Het
Cul3 A C 1: 80,269,294 D697E probably benign Het
Defa34 G A 8: 21,665,962 E56K probably benign Het
Dhrs7c A G 11: 67,809,815 R63G probably damaging Het
Dnah3 T A 7: 119,951,752 K136* probably null Het
Exoc7 T C 11: 116,295,316 D353G possibly damaging Het
Fbxw21 T C 9: 109,143,840 Y342C probably benign Het
Fitm2 T A 2: 163,470,066 I76F probably damaging Het
Fryl A T 5: 73,083,384 I1291N probably benign Het
Gm13089 C T 4: 143,697,106 S371N possibly damaging Het
Gm5592 A T 7: 41,289,859 Y855F probably damaging Het
Helz2 T C 2: 181,233,991 Y1570C probably benign Het
Hist1h1t A G 13: 23,696,200 K112R possibly damaging Het
Hist4h4 G T 6: 136,804,283 P33T possibly damaging Het
Ints11 A G 4: 155,885,683 T228A probably benign Het
Ipo13 G T 4: 117,914,297 N25K probably benign Het
Itga9 T A 9: 118,871,900 I917N probably damaging Het
Krtap13-1 C T 16: 88,729,173 T95I possibly damaging Het
Ldlrad4 G T 18: 68,235,792 E107* probably null Het
Lrrc6 T G 15: 66,449,552 I247L probably benign Het
Ly6a A T 15: 74,997,567 I13N probably damaging Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Mgat3 C T 15: 80,211,542 T190M probably damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mucl1 G T 15: 103,753,684 N85K possibly damaging Het
Nifk G A 1: 118,327,661 E96K possibly damaging Het
Olfr290 T A 7: 84,916,531 F251I probably damaging Het
Olfr600 T C 7: 103,346,530 R133G possibly damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Opn3 C T 1: 175,662,905 V397M probably damaging Het
Pcdha2 A G 18: 36,941,526 M737V probably benign Het
Pdk4 T A 6: 5,492,757 D98V possibly damaging Het
Pkhd1l1 A G 15: 44,540,907 T2311A probably benign Het
Pla2r1 A T 2: 60,530,458 C195* probably null Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprq T C 10: 107,643,669 T1166A probably damaging Het
Ran G A 5: 129,022,810 D215N probably benign Het
Rb1cc1 T C 1: 6,248,085 F604L possibly damaging Het
Rgl1 T A 1: 152,554,350 E227D probably benign Het
Sec24b C A 3: 129,984,197 R1204L possibly damaging Het
Shroom3 T C 5: 92,950,489 L1276P probably damaging Het
Smarcad1 T A 6: 65,107,830 M820K probably damaging Het
Sptbn1 A T 11: 30,142,142 M541K probably damaging Het
Tcp11l2 T C 10: 84,604,983 V351A possibly damaging Het
Tecpr2 A G 12: 110,933,172 D658G probably benign Het
Tlr6 T G 5: 64,953,385 E726D probably damaging Het
Tmem218 T A 9: 37,222,568 H101Q probably benign Het
Tnfrsf4 C T 4: 156,014,338 Q82* probably null Het
Trpm7 A G 2: 126,813,238 V1260A probably benign Het
Trpm8 A T 1: 88,330,841 E282V probably damaging Het
Ttll3 AGTA AGTAGTGTA 6: 113,399,160 probably null Het
Tuba8 T C 6: 121,223,389 V344A probably damaging Het
Tvp23a A G 16: 10,427,381 probably null Het
Zfp174 G A 16: 3,849,351 V135M probably damaging Het
Zfp418 G A 7: 7,182,777 V580I possibly damaging Het
Zfp451 T A 1: 33,805,393 E44D probably benign Het
Zfp521 T C 18: 13,845,781 D525G probably benign Het
Other mutations in Fzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Fzd2 APN 11 102605782 missense possibly damaging 0.94
IGL02034:Fzd2 APN 11 102604904 missense probably damaging 1.00
IGL02035:Fzd2 APN 11 102606444 makesense probably null
PIT4585001:Fzd2 UTSW 11 102605747 missense probably damaging 0.99
R0201:Fzd2 UTSW 11 102606122 missense probably damaging 1.00
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1530:Fzd2 UTSW 11 102605308 missense probably benign 0.00
R1589:Fzd2 UTSW 11 102606328 missense probably benign 0.06
R1676:Fzd2 UTSW 11 102605881 missense probably damaging 1.00
R2057:Fzd2 UTSW 11 102605933 missense probably damaging 1.00
R2219:Fzd2 UTSW 11 102605423 missense probably benign 0.01
R2410:Fzd2 UTSW 11 102605627 missense possibly damaging 0.71
R5058:Fzd2 UTSW 11 102604807 missense probably damaging 0.99
R5296:Fzd2 UTSW 11 102606155 missense probably damaging 0.96
R5580:Fzd2 UTSW 11 102605839 missense probably damaging 0.99
R5788:Fzd2 UTSW 11 102605467 missense probably benign 0.03
R6104:Fzd2 UTSW 11 102606335 missense probably damaging 1.00
R6452:Fzd2 UTSW 11 102604985 missense probably damaging 1.00
R7454:Fzd2 UTSW 11 102605129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGTTCGGCTTCCAATGGC -3'
(R):5'- TCATTGCATACCACGCGCTC -3'

Sequencing Primer
(F):5'- AGATCTGCGTGGGCCAGAAC -3'
(R):5'- TCCTGGAGAACGAAGCCC -3'
Posted On2019-11-26