Incidental Mutation 'R7774:Tecpr2'
ID598785
Institutional Source Beutler Lab
Gene Symbol Tecpr2
Ensembl Gene ENSMUSG00000021275
Gene Nametectonin beta-propeller repeat containing 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7774 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location110889264-110972394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110933172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 658 (D658G)
Ref Sequence ENSEMBL: ENSMUSP00000127949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]
Predicted Effect probably benign
Transcript: ENSMUST00000165978
AA Change: D658G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: D658G

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169597
AA Change: D658G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: D658G

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223210
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 G T 15: 98,596,533 T809N probably benign Het
Adgb C A 10: 10,339,660 E1561* probably null Het
Adgra1 A T 7: 139,847,712 H65L possibly damaging Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Atrnl1 G T 19: 57,699,671 G856V probably damaging Het
Cc2d2b A G 19: 40,765,717 K177E unknown Het
Ccdc122 T C 14: 77,067,939 V11A probably benign Het
Col6a1 T C 10: 76,709,876 T921A unknown Het
Cul3 A C 1: 80,269,294 D697E probably benign Het
Defa34 G A 8: 21,665,962 E56K probably benign Het
Dhrs7c A G 11: 67,809,815 R63G probably damaging Het
Dnah3 T A 7: 119,951,752 K136* probably null Het
Exoc7 T C 11: 116,295,316 D353G possibly damaging Het
Fbxw21 T C 9: 109,143,840 Y342C probably benign Het
Fitm2 T A 2: 163,470,066 I76F probably damaging Het
Fryl A T 5: 73,083,384 I1291N probably benign Het
Fzd2 A T 11: 102,605,488 I253F possibly damaging Het
Gm13089 C T 4: 143,697,106 S371N possibly damaging Het
Gm5592 A T 7: 41,289,859 Y855F probably damaging Het
Helz2 T C 2: 181,233,991 Y1570C probably benign Het
Hist1h1t A G 13: 23,696,200 K112R possibly damaging Het
Hist4h4 G T 6: 136,804,283 P33T possibly damaging Het
Ints11 A G 4: 155,885,683 T228A probably benign Het
Ipo13 G T 4: 117,914,297 N25K probably benign Het
Itga9 T A 9: 118,871,900 I917N probably damaging Het
Krtap13-1 C T 16: 88,729,173 T95I possibly damaging Het
Ldlrad4 G T 18: 68,235,792 E107* probably null Het
Lrrc6 T G 15: 66,449,552 I247L probably benign Het
Ly6a A T 15: 74,997,567 I13N probably damaging Het
Mfsd4b4 T C 10: 39,892,411 T275A probably benign Het
Mgat3 C T 15: 80,211,542 T190M probably damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mucl1 G T 15: 103,753,684 N85K possibly damaging Het
Nifk G A 1: 118,327,661 E96K possibly damaging Het
Olfr290 T A 7: 84,916,531 F251I probably damaging Het
Olfr600 T C 7: 103,346,530 R133G possibly damaging Het
Olfr895 T C 9: 38,269,359 V274A probably damaging Het
Opn3 C T 1: 175,662,905 V397M probably damaging Het
Pcdha2 A G 18: 36,941,526 M737V probably benign Het
Pdk4 T A 6: 5,492,757 D98V possibly damaging Het
Pkhd1l1 A G 15: 44,540,907 T2311A probably benign Het
Pla2r1 A T 2: 60,530,458 C195* probably null Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprq T C 10: 107,643,669 T1166A probably damaging Het
Ran G A 5: 129,022,810 D215N probably benign Het
Rb1cc1 T C 1: 6,248,085 F604L possibly damaging Het
Rgl1 T A 1: 152,554,350 E227D probably benign Het
Sec24b C A 3: 129,984,197 R1204L possibly damaging Het
Shroom3 T C 5: 92,950,489 L1276P probably damaging Het
Smarcad1 T A 6: 65,107,830 M820K probably damaging Het
Sptbn1 A T 11: 30,142,142 M541K probably damaging Het
Tcp11l2 T C 10: 84,604,983 V351A possibly damaging Het
Tlr6 T G 5: 64,953,385 E726D probably damaging Het
Tmem218 T A 9: 37,222,568 H101Q probably benign Het
Tnfrsf4 C T 4: 156,014,338 Q82* probably null Het
Trpm7 A G 2: 126,813,238 V1260A probably benign Het
Trpm8 A T 1: 88,330,841 E282V probably damaging Het
Ttll3 AGTA AGTAGTGTA 6: 113,399,160 probably null Het
Tuba8 T C 6: 121,223,389 V344A probably damaging Het
Tvp23a A G 16: 10,427,381 probably null Het
Zfp174 G A 16: 3,849,351 V135M probably damaging Het
Zfp418 G A 7: 7,182,777 V580I possibly damaging Het
Zfp451 T A 1: 33,805,393 E44D probably benign Het
Zfp521 T C 18: 13,845,781 D525G probably benign Het
Other mutations in Tecpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tecpr2 APN 12 110967779 missense possibly damaging 0.67
IGL01759:Tecpr2 APN 12 110931392 utr 3 prime probably benign
IGL02114:Tecpr2 APN 12 110968887 missense probably damaging 1.00
IGL02813:Tecpr2 APN 12 110933192 missense probably damaging 1.00
IGL02943:Tecpr2 APN 12 110967749 missense probably benign
IGL03085:Tecpr2 APN 12 110954826 splice site probably benign
IGL03290:Tecpr2 APN 12 110967833 missense possibly damaging 0.65
R0362:Tecpr2 UTSW 12 110968940 missense probably damaging 0.96
R0486:Tecpr2 UTSW 12 110896369 missense probably benign 0.01
R0662:Tecpr2 UTSW 12 110896228 missense probably benign 0.02
R0787:Tecpr2 UTSW 12 110946343 missense probably benign 0.30
R1147:Tecpr2 UTSW 12 110941438 splice site probably benign
R1454:Tecpr2 UTSW 12 110968953 missense probably benign 0.00
R1513:Tecpr2 UTSW 12 110954800 missense possibly damaging 0.94
R1567:Tecpr2 UTSW 12 110941596 critical splice donor site probably null
R1569:Tecpr2 UTSW 12 110944887 critical splice donor site probably null
R1818:Tecpr2 UTSW 12 110926454 missense probably damaging 1.00
R1856:Tecpr2 UTSW 12 110933064 missense probably benign
R1897:Tecpr2 UTSW 12 110933247 missense probably benign
R1903:Tecpr2 UTSW 12 110947912 missense probably damaging 0.98
R1939:Tecpr2 UTSW 12 110933169 missense probably damaging 0.98
R1982:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R2073:Tecpr2 UTSW 12 110968429 missense possibly damaging 0.51
R2393:Tecpr2 UTSW 12 110926402 missense probably damaging 0.99
R2443:Tecpr2 UTSW 12 110896325 missense probably damaging 1.00
R2484:Tecpr2 UTSW 12 110933318 missense probably benign
R4564:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R4723:Tecpr2 UTSW 12 110932976 missense probably benign 0.01
R4835:Tecpr2 UTSW 12 110954730 missense probably benign 0.00
R4847:Tecpr2 UTSW 12 110939877 missense probably damaging 1.00
R4911:Tecpr2 UTSW 12 110931487 missense possibly damaging 0.74
R5179:Tecpr2 UTSW 12 110944693 missense possibly damaging 0.63
R5266:Tecpr2 UTSW 12 110915402 missense probably damaging 1.00
R5386:Tecpr2 UTSW 12 110915453 missense probably damaging 1.00
R5486:Tecpr2 UTSW 12 110933015 missense probably benign 0.03
R5490:Tecpr2 UTSW 12 110914684 missense probably damaging 1.00
R5627:Tecpr2 UTSW 12 110941482 missense probably damaging 0.97
R5836:Tecpr2 UTSW 12 110931511 missense possibly damaging 0.76
R6052:Tecpr2 UTSW 12 110918891 missense possibly damaging 0.89
R6084:Tecpr2 UTSW 12 110929109 missense probably damaging 0.98
R6306:Tecpr2 UTSW 12 110944751 missense probably damaging 1.00
R6563:Tecpr2 UTSW 12 110929087 missense probably benign 0.00
R6936:Tecpr2 UTSW 12 110944863 missense possibly damaging 0.83
R6977:Tecpr2 UTSW 12 110939766 missense probably benign 0.17
R7110:Tecpr2 UTSW 12 110918972 missense probably damaging 1.00
R7132:Tecpr2 UTSW 12 110915372 missense probably damaging 0.97
R7353:Tecpr2 UTSW 12 110967844 missense probably benign 0.06
R7362:Tecpr2 UTSW 12 110941476 missense possibly damaging 0.85
R7366:Tecpr2 UTSW 12 110915480 critical splice donor site probably null
R7404:Tecpr2 UTSW 12 110931604 missense probably benign 0.00
R7478:Tecpr2 UTSW 12 110968439 missense probably benign 0.36
R7997:Tecpr2 UTSW 12 110933603 missense probably benign 0.02
R8037:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8038:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
Z1176:Tecpr2 UTSW 12 110896310 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTACCCTTGCAGCCAGAGG -3'
(R):5'- AAAAGTGGGTGTTTCCTTCTGAC -3'

Sequencing Primer
(F):5'- TTGCAGCCAGAGGAGGATGTG -3'
(R):5'- TGTGTTACTGTCAGTTAGTAAATGCC -3'
Posted On2019-11-26