Incidental Mutation 'R7775:Atp6v0a2'
ID 598817
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock # R7775 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124628576-124724455 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124641505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 186 (E186G)
Ref Sequence ENSEMBL: ENSMUSP00000039737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
AlphaFold P15920
PDB Structure NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000037865
AA Change: E186G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: E186G

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Meta Mutation Damage Score 0.3041 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Car4 T C 11: 84,965,623 S246P probably damaging Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Fstl4 C T 11: 53,176,971 Q554* probably null Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
L3mbtl3 A T 10: 26,352,317 V15E unknown Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124721777 missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124646028 missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124636105 missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124646014 missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124721785 missense probably benign
IGL02650:Atp6v0a2 APN 5 124712362 splice site probably benign
IGL02687:Atp6v0a2 APN 5 124714142 missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124629202 missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124712781 missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124714107 splice site probably benign
IGL03198:Atp6v0a2 APN 5 124712361 critical splice donor site probably null
alkaline UTSW 5 124719866 missense probably damaging 1.00
basic UTSW 5 124712328 nonsense probably null
electronegative UTSW 5 124646698 missense probably damaging 1.00
energizer UTSW 5 124719986 missense probably damaging 0.98
Everready UTSW 5 124641505 missense probably damaging 0.99
Lithium UTSW 5 124714145 missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124713184 missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124717982 missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124646698 missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124718488 missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124627144 unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124712796 missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124646734 missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124646727 missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124713185 missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124713177 missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124646709 missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124645969 nonsense probably null
R5830:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124716327 missense probably benign
R5903:Atp6v0a2 UTSW 5 124712279 missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124629203 missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124713130 missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124641514 missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124712161 splice site probably null
R6994:Atp6v0a2 UTSW 5 124714145 missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124645983 missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124719866 missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124646736 missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124712328 nonsense probably null
R7714:Atp6v0a2 UTSW 5 124637595 missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124714198 missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124716496 missense probably benign 0.00
R7778:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124645031 missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R7977:Atp6v0a2 UTSW 5 124719986 missense probably damaging 0.98
R7987:Atp6v0a2 UTSW 5 124719986 missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124712773 missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124719088 missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124716470 missense probably damaging 1.00
R8945:Atp6v0a2 UTSW 5 124646649 missense probably damaging 1.00
R8971:Atp6v0a2 UTSW 5 124719997 missense probably damaging 1.00
R9023:Atp6v0a2 UTSW 5 124719074 missense possibly damaging 0.93
R9300:Atp6v0a2 UTSW 5 124712248 missense probably damaging 0.98
R9360:Atp6v0a2 UTSW 5 124629194 missense possibly damaging 0.77
R9601:Atp6v0a2 UTSW 5 124713193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCAGCTTCAGCAATCC -3'
(R):5'- TCAATGTAGGGCTCCAGGAG -3'

Sequencing Primer
(F):5'- ATCCTTTGTCCAGCACACAGG -3'
(R):5'- GCATCTTTGGGTACTCACAAAACGG -3'
Posted On 2019-11-26