Mutagenetix > Incidental Mutation

Incidental Mutation 'R7775:Or8b36'

598836

Institutional Source

Beutler Lab

Gene Symbol

Or8b36

Ensembl Gene

ENSMUSG00000094461

Gene Name

olfactory receptor family 8 subfamily B member 36

Synonyms

MOR162-6, Olfr883, GA_x6K02T2PVTD-31705144-31706073

MMRRC Submission

045831-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R7775 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37937104-37938033 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37937963 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 287 (I287N)

Ref Sequence

ENSEMBL: ENSMUSP00000072741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072974]

AlphaFold

Q8VF64

Predicted Effect

probably damaging
Transcript: ENSMUST00000072974
AA Change: I287N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072741
Gene: ENSMUSG00000094461
AA Change: I287N

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	306	1.6e-48	PFAM
Pfam:7tm_1	41	288	3.7e-24	PFAM

Meta Mutation Damage Score

0.8477

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgap35	T	C	7: 16,296,573 (GRCm39)	K831E	probably benign	Het
Arpc1a	C	T	5: 145,041,622 (GRCm39)	R302C	probably benign	Het
Asb5	A	C	8: 55,037,827 (GRCm39)	H173P		Het
Atp6v0a2	A	G	5: 124,779,443 (GRCm39)	E186G	probably damaging	Het
Bbs2	A	T	8: 94,816,388 (GRCm39)		probably null	Het
Capn7	A	G	14: 31,074,367 (GRCm39)	T257A	probably benign	Het
Car4	T	C	11: 84,856,449 (GRCm39)	S246P	probably damaging	Het
Chrm5	A	G	2: 112,310,301 (GRCm39)	S272P	probably benign	Het
Chrna6	T	C	8: 27,897,392 (GRCm39)	I162V	probably damaging	Het
Chst12	T	A	5: 140,509,376 (GRCm39)	M1K	probably null	Het
Cldn6	T	A	17: 23,900,581 (GRCm39)	C182S	probably damaging	Het
Coro6	T	G	11: 77,356,599 (GRCm39)	D102E	probably benign	Het
Cysltr2	A	G	14: 73,267,203 (GRCm39)	I169T	probably benign	Het
Dtx4	G	T	19: 12,469,374 (GRCm39)	P251Q	probably benign	Het
Dyrk3	C	T	1: 131,057,364 (GRCm39)	V270I	possibly damaging	Het
Efhc1	A	T	1: 21,049,685 (GRCm39)	Y515F	probably damaging	Het
Ep300	T	C	15: 81,470,887 (GRCm39)	S20P	unknown	Het
Fmnl2	C	T	2: 52,963,692 (GRCm39)	L275F	unknown	Het
Fstl4	C	T	11: 53,067,798 (GRCm39)	Q554*	probably null	Het
Gal3st2b	G	T	1: 93,868,506 (GRCm39)	D246Y	probably damaging	Het
Gkap1	A	T	13: 58,398,966 (GRCm39)	D188E	probably benign	Het
Gm14226	T	A	2: 154,866,630 (GRCm39)	C196S	possibly damaging	Het
Gm8297	A	G	14: 16,167,939 (GRCm39)	N193S	possibly damaging	Het
Grm8	T	C	6: 27,363,671 (GRCm39)	R615G	possibly damaging	Het
Ing1	A	G	8: 11,611,814 (GRCm39)	E178G	probably benign	Het
Kansl3	A	T	1: 36,387,758 (GRCm39)	L530H	probably damaging	Het
Kcna5	A	T	6: 126,511,768 (GRCm39)	L120*	probably null	Het
Kif26b	T	A	1: 178,692,441 (GRCm39)	S461T	probably benign	Het
L3mbtl3	A	T	10: 26,228,215 (GRCm39)	V15E	unknown	Het
Lama4	A	T	10: 38,954,843 (GRCm39)	H1132L	probably damaging	Het
Ldlrad4	G	T	18: 68,368,740 (GRCm39)	A66S	possibly damaging	Het
Ldlrad4	T	C	18: 68,368,827 (GRCm39)	S95P	probably damaging	Het
Liph	G	T	16: 21,777,664 (GRCm39)	L379I	probably damaging	Het
Lrp2	T	A	2: 69,331,883 (GRCm39)	E1624V	possibly damaging	Het
Matn2	A	T	15: 34,399,223 (GRCm39)	H370L	possibly damaging	Het
Mettl23	T	G	11: 116,740,096 (GRCm39)	V189G	probably benign	Het
Mpp4	G	A	1: 59,162,672 (GRCm39)	T543M	not run	Het
Mrps15	A	T	4: 125,945,170 (GRCm39)	N119I	probably damaging	Het
Or10d4	C	A	9: 39,580,534 (GRCm39)	F60L	possibly damaging	Het
Or5ac21	A	T	16: 59,123,614 (GRCm39)	I33F	probably damaging	Het
Or7d9	A	G	9: 20,193,708 (GRCm39)		probably benign	Het
Or8g21	T	A	9: 38,906,203 (GRCm39)	H176L	probably damaging	Het
Pax8	A	G	2: 24,325,913 (GRCm39)	S324P	possibly damaging	Het
Pcdha11	A	T	18: 37,145,733 (GRCm39)	Y608F	possibly damaging	Het
Pcdhga5	A	G	18: 37,828,578 (GRCm39)	D342G	probably damaging	Het
Pde6d	A	G	1: 86,471,250 (GRCm39)	S143P	probably damaging	Het
Plau	A	G	14: 20,892,393 (GRCm39)	S393G	probably benign	Het
Plec	A	T	15: 76,061,135 (GRCm39)	I2934N	probably damaging	Het
Primpol	G	T	8: 47,039,459 (GRCm39)	P387Q	probably damaging	Het
Prph2	T	C	17: 47,221,732 (GRCm39)	L37S	possibly damaging	Het
Prrt4	A	G	6: 29,177,718 (GRCm39)	L17P	probably damaging	Het
Pycr3	T	C	15: 75,790,138 (GRCm39)	D171G	probably damaging	Het
Rapgefl1	A	G	11: 98,741,980 (GRCm39)	N648S	probably damaging	Het
Rapsn	A	G	2: 90,875,293 (GRCm39)	T359A	probably benign	Het
Sap25	C	T	5: 137,640,186 (GRCm39)	R66W	probably benign	Het
Setd6	A	T	8: 96,442,866 (GRCm39)	H101L	probably benign	Het
Slc22a3	G	T	17: 12,683,350 (GRCm39)	A171E	probably damaging	Het
Tbc1d2	C	T	4: 46,637,746 (GRCm39)		probably null	Het
Tfap2b	G	A	1: 19,304,531 (GRCm39)	G447D	probably damaging	Het
Txndc2	A	G	17: 65,945,238 (GRCm39)	V313A	probably benign	Het
Uevld	A	T	7: 46,576,100 (GRCm39)	I462N	probably damaging	Het
Vmn2r120	T	C	17: 57,832,942 (GRCm39)	Y79C	probably damaging	Het
Vwa8	T	C	14: 79,275,587 (GRCm39)	V790A	probably benign	Het
Zfp936	A	G	7: 42,839,720 (GRCm39)	T396A	possibly damaging	Het

Other mutations in Or8b36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00980:Or8b36	APN	9	37,937,107 (GRCm39)	missense	probably benign	0.02
IGL02092:Or8b36	APN	9	37,937,917 (GRCm39)	missense	possibly damaging	0.80
IGL02351:Or8b36	APN	9	37,937,332 (GRCm39)	missense	possibly damaging	0.78
IGL02358:Or8b36	APN	9	37,937,332 (GRCm39)	missense	possibly damaging	0.78
IGL02807:Or8b36	APN	9	37,937,485 (GRCm39)	missense	probably damaging	1.00
R0972:Or8b36	UTSW	9	37,937,856 (GRCm39)	missense	possibly damaging	0.88
R1016:Or8b36	UTSW	9	37,937,987 (GRCm39)	missense	probably damaging	0.98
R1818:Or8b36	UTSW	9	37,937,803 (GRCm39)	missense	probably damaging	1.00
R4466:Or8b36	UTSW	9	37,937,479 (GRCm39)	missense	probably damaging	0.99
R4871:Or8b36	UTSW	9	37,937,822 (GRCm39)	missense	probably damaging	1.00
R5977:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R5979:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6026:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6027:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6029:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6035:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6035:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6053:Or8b36	UTSW	9	37,937,837 (GRCm39)	frame shift	probably null
R6092:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6106:Or8b36	UTSW	9	37,937,762 (GRCm39)	missense	probably damaging	1.00
R6131:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6132:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6133:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6134:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6153:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6251:Or8b36	UTSW	9	37,937,842 (GRCm39)	frame shift	probably null
R6251:Or8b36	UTSW	9	37,937,841 (GRCm39)	frame shift	probably null
R6251:Or8b36	UTSW	9	37,937,833 (GRCm39)	frame shift	probably null
R6251:Or8b36	UTSW	9	37,937,844 (GRCm39)	frame shift	probably null
R6300:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6301:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6305:Or8b36	UTSW	9	37,937,838 (GRCm39)	frame shift	probably null
R6305:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6307:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6312:Or8b36	UTSW	9	37,937,842 (GRCm39)	frame shift	probably null
R6312:Or8b36	UTSW	9	37,937,837 (GRCm39)	frame shift	probably null
R6312:Or8b36	UTSW	9	37,937,836 (GRCm39)	frame shift	probably null
R6312:Or8b36	UTSW	9	37,937,845 (GRCm39)	frame shift	probably null
R6312:Or8b36	UTSW	9	37,937,843 (GRCm39)	nonsense	probably null
R6813:Or8b36	UTSW	9	37,937,129 (GRCm39)	missense	probably damaging	1.00
R7134:Or8b36	UTSW	9	37,937,795 (GRCm39)	missense	probably benign	0.00
R7778:Or8b36	UTSW	9	37,937,963 (GRCm39)	missense	probably damaging	1.00
R7984:Or8b36	UTSW	9	37,937,155 (GRCm39)	missense	probably damaging	1.00
R8326:Or8b36	UTSW	9	37,938,014 (GRCm39)	missense	probably benign	0.00
R9154:Or8b36	UTSW	9	37,937,690 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTCATAGTTCCCACCCTGACAATC -3'
(R):5'- AGCAAATCCTATGTCAGTTACCTAC -3'

Sequencing Primer
(F):5'- CATCCATTCTGCAGAAGGTAGGTC -3'
(R):5'- AATCCTATGTCAGTTACCTACTACAC -3'

Posted On

2019-11-26