Incidental Mutation 'R7775:L3mbtl3'
ID598839
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7775 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26352317 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 15 (V15E)
Ref Sequence ENSEMBL: ENSMUSP00000101158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect unknown
Transcript: ENSMUST00000040219
AA Change: V15E
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: V15E

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105519
AA Change: V15E
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: V15E

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174766
AA Change: V15E
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: V15E

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Car4 T C 11: 84,965,623 S246P probably damaging Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Fstl4 C T 11: 53,176,971 Q554* probably null Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Ttll3 AAAGT AAAGTTAAGT 6: 113,399,158 probably null Het
Ttll3 AGTAAG AGTAAGGTAAG 6: 113,399,160 probably null Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0497:L3mbtl3 UTSW 10 26282874 splice site probably benign
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
R7490:L3mbtl3 UTSW 10 26339231 missense unknown
R7815:L3mbtl3 UTSW 10 26280378 missense unknown
Z1177:L3mbtl3 UTSW 10 26280402 nonsense probably null
Z1177:L3mbtl3 UTSW 10 26302663 missense not run
Predicted Primers PCR Primer
(F):5'- GTTGTAAAACAAGCTGACTGCAG -3'
(R):5'- CAAGTACTCTCCCAGGGTCTCTATC -3'

Sequencing Primer
(F):5'- CACACACACACTTGTGTA -3'
(R):5'- CCATTCACGATGCTTTGGAG -3'
Posted On2019-11-26