Incidental Mutation 'R7775:Fstl4'
ID598841
Institutional Source Beutler Lab
Gene Symbol Fstl4
Ensembl Gene ENSMUSG00000036264
Gene Namefollistatin-like 4
SynonymsSPIG1, B230374F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7775 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52764634-53188538 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 53176971 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 554 (Q554*)
Ref Sequence ENSEMBL: ENSMUSP00000042007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036796]
Predicted Effect probably null
Transcript: ENSMUST00000036796
AA Change: Q554*
SMART Domains Protein: ENSMUSP00000042007
Gene: ENSMUSG00000036264
AA Change: Q554*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 87 132 4.7e-13 SMART
Blast:IG_like 215 241 6e-7 BLAST
IGc2 260 327 1.9e-6 SMART
IGc2 352 419 1e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice were born at expected Mendelian ratio and healthy, fertile, apparently normal with normal retinal laminar structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Car4 T C 11: 84,965,623 S246P probably damaging Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
L3mbtl3 A T 10: 26,352,317 V15E unknown Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in Fstl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fstl4 APN 11 53186275 missense probably benign 0.01
IGL00885:Fstl4 APN 11 53148982 missense possibly damaging 0.90
IGL00915:Fstl4 APN 11 53176998 missense probably benign
IGL00933:Fstl4 APN 11 53186761 missense possibly damaging 0.80
IGL01022:Fstl4 APN 11 53186741 missense probably benign 0.18
IGL01121:Fstl4 APN 11 52814637 missense probably benign 0.00
IGL01656:Fstl4 APN 11 53000374 missense probably damaging 1.00
IGL01805:Fstl4 APN 11 53186357 missense probably damaging 1.00
IGL01997:Fstl4 APN 11 53163054 nonsense probably null
IGL02386:Fstl4 APN 11 52773871 missense probably benign 0.21
IGL02536:Fstl4 APN 11 53134024 splice site probably benign
IGL02807:Fstl4 APN 11 53186674 missense probably benign 0.03
IGL03037:Fstl4 APN 11 53168223 missense possibly damaging 0.83
R0462:Fstl4 UTSW 11 53186402 missense probably benign 0.09
R1190:Fstl4 UTSW 11 53068546 missense probably benign
R1300:Fstl4 UTSW 11 53068627 missense probably benign
R1626:Fstl4 UTSW 11 53000290 nonsense probably null
R1695:Fstl4 UTSW 11 53165878 splice site probably null
R1699:Fstl4 UTSW 11 53168178 missense possibly damaging 0.81
R1727:Fstl4 UTSW 11 53068651 missense probably damaging 1.00
R1752:Fstl4 UTSW 11 53186795 missense probably benign 0.09
R1866:Fstl4 UTSW 11 53186398 missense probably benign 0.00
R4689:Fstl4 UTSW 11 53068650 nonsense probably null
R5126:Fstl4 UTSW 11 53186561 missense possibly damaging 0.71
R5129:Fstl4 UTSW 11 53186439 missense probably damaging 1.00
R5499:Fstl4 UTSW 11 53068547 missense probably benign 0.01
R5578:Fstl4 UTSW 11 53165781 missense probably damaging 1.00
R5715:Fstl4 UTSW 11 53000416 missense possibly damaging 0.53
R6125:Fstl4 UTSW 11 53186303 missense probably benign
R6177:Fstl4 UTSW 11 53168204 missense probably benign 0.00
R6236:Fstl4 UTSW 11 53186335 missense probably benign 0.00
R6311:Fstl4 UTSW 11 53176977 missense probably damaging 1.00
R6611:Fstl4 UTSW 11 53186725 missense probably benign 0.01
R6886:Fstl4 UTSW 11 53186450 missense probably damaging 1.00
R7404:Fstl4 UTSW 11 53134071 missense probably benign 0.03
R7423:Fstl4 UTSW 11 53068555 missense possibly damaging 0.54
R7586:Fstl4 UTSW 11 53072429 missense probably benign 0.00
R7756:Fstl4 UTSW 11 53168296 missense possibly damaging 0.69
R7758:Fstl4 UTSW 11 53168296 missense possibly damaging 0.69
R7953:Fstl4 UTSW 11 53000223 missense probably benign 0.01
R8026:Fstl4 UTSW 11 53068669 missense probably damaging 0.99
R8043:Fstl4 UTSW 11 53000223 missense probably benign 0.01
R8375:Fstl4 UTSW 11 53162675 missense possibly damaging 0.63
R8866:Fstl4 UTSW 11 53072406 missense possibly damaging 0.54
X0013:Fstl4 UTSW 11 53162619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTTGGCTAGGGCTCAAG -3'
(R):5'- ACTGTGAATTGCCTAATGGGTG -3'

Sequencing Primer
(F):5'- GCTCAAGGCCAACTTCCTAACTC -3'
(R):5'- ACAGCCCAGCACTGTTTGTATAGG -3'
Posted On2019-11-26