Incidental Mutation 'R7775:Car4'
ID598843
Institutional Source Beutler Lab
Gene Symbol Car4
Ensembl Gene ENSMUSG00000000805
Gene Namecarbonic anhydrase 4
SynonymsCA IV
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R7775 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location84957786-84966044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84965623 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 246 (S246P)
Ref Sequence ENSEMBL: ENSMUSP00000099483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103194] [ENSMUST00000127827] [ENSMUST00000150596]
PDB Structure
MURINE CARBONIC ANHYDRASE IV [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE IV COMPLEXED WITH BRINZOLAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000103194
AA Change: S246P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099483
Gene: ENSMUSG00000000805
AA Change: S246P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Carb_anhydrase 22 278 2.37e-103 SMART
low complexity region 283 299 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000103711
Gene: ENSMUSG00000000805
AA Change: S104P

DomainStartEndE-ValueType
Carb_anhydrase 3 137 9.49e-7 SMART
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127827
Predicted Effect probably benign
Transcript: ENSMUST00000150596
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes a glycosylphosphatidyl-inositol-anchored membrane isozyme expressed on the luminal surfaces of pulmonary (and certain other) capillaries and proximal renal tubules. Its exact function is not known; however, it may have a role in inherited renal abnormalities of bicarbonate transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are produced in lower than expected numbers, with females preferentially lost in the fetal or early postnatal period. Surviving homozygotes are healthy and fertile when crossed with wild-type partners; however, homozygous intercrosses yield small litters and pups do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Fstl4 C T 11: 53,176,971 Q554* probably null Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
L3mbtl3 A T 10: 26,352,317 V15E unknown Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in Car4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Car4 APN 11 84965767 missense probably damaging 1.00
IGL01121:Car4 APN 11 84964346 critical splice acceptor site probably null
IGL01828:Car4 APN 11 84964745 missense probably benign 0.19
IGL02340:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02351:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02353:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02358:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02360:Car4 APN 11 84965767 missense probably damaging 1.00
PIT4802001:Car4 UTSW 11 84964405 missense probably damaging 1.00
R0008:Car4 UTSW 11 84963411 unclassified probably benign
R0501:Car4 UTSW 11 84963442 missense probably benign 0.01
R2124:Car4 UTSW 11 84964085 splice site probably benign
R3907:Car4 UTSW 11 84964357 missense probably damaging 1.00
R5072:Car4 UTSW 11 84963367 missense probably benign
R5268:Car4 UTSW 11 84965800 missense probably benign 0.28
R5562:Car4 UTSW 11 84964098 missense probably benign 0.05
R6508:Car4 UTSW 11 84965643 missense possibly damaging 0.64
Z1177:Car4 UTSW 11 84963419 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGAGGACCAAACTCCCTTG -3'
(R):5'- TGGAGGAAGTTGGCTACCAG -3'

Sequencing Primer
(F):5'- CTATCGAATCAGATATCCTGGGGC -3'
(R):5'- CCAGGCAGGTGAGTGTG -3'
Posted On2019-11-26