Incidental Mutation 'R7775:Rapgefl1'
ID598844
Institutional Source Beutler Lab
Gene Symbol Rapgefl1
Ensembl Gene ENSMUSG00000038020
Gene NameRap guanine nucleotide exchange factor (GEF)-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7775 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98836785-98853697 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98851154 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 648 (N648S)
Ref Sequence ENSEMBL: ENSMUSP00000103103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107479]
Predicted Effect probably damaging
Transcript: ENSMUST00000107479
AA Change: N648S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103103
Gene: ENSMUSG00000038020
AA Change: N648S

DomainStartEndE-ValueType
low complexity region 22 49 N/A INTRINSIC
low complexity region 50 65 N/A INTRINSIC
low complexity region 70 100 N/A INTRINSIC
low complexity region 108 133 N/A INTRINSIC
low complexity region 169 180 N/A INTRINSIC
RasGEF 420 661 2.39e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 T C 7: 16,562,648 K831E probably benign Het
Arpc1a C T 5: 145,104,812 R302C probably benign Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Car4 T C 11: 84,965,623 S246P probably damaging Het
Chrm5 A G 2: 112,479,956 S272P probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Chst12 T A 5: 140,523,621 M1K probably null Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Coro6 T G 11: 77,465,773 D102E probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Dtx4 G T 19: 12,492,010 P251Q probably benign Het
Dyrk3 C T 1: 131,129,627 V270I possibly damaging Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Ep300 T C 15: 81,586,686 S20P unknown Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Fstl4 C T 11: 53,176,971 Q554* probably null Het
Gal3st2b G T 1: 93,940,784 D246Y probably damaging Het
Gkap1 A T 13: 58,251,152 D188E probably benign Het
Gm14226 T A 2: 155,024,710 C196S possibly damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Grm8 T C 6: 27,363,672 R615G possibly damaging Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Kansl3 A T 1: 36,348,677 L530H probably damaging Het
Kcna5 A T 6: 126,534,805 L120* probably null Het
Kif26b T A 1: 178,864,876 S461T probably benign Het
L3mbtl3 A T 10: 26,352,317 V15E unknown Het
Lama4 A T 10: 39,078,847 H1132L probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ldlrad4 T C 18: 68,235,756 S95P probably damaging Het
Liph G T 16: 21,958,914 L379I probably damaging Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Matn2 A T 15: 34,399,077 H370L possibly damaging Het
Mettl23 T G 11: 116,849,270 V189G probably benign Het
Mpp4 G A 1: 59,123,513 T543M not run Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Olfr203 A T 16: 59,303,251 I33F probably damaging Het
Olfr39 A G 9: 20,282,412 probably benign Het
Olfr883 T A 9: 38,026,667 I287N probably damaging Het
Olfr935 T A 9: 38,994,907 H176L probably damaging Het
Olfr963 C A 9: 39,669,238 F60L possibly damaging Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Pcdha11 A T 18: 37,012,680 Y608F possibly damaging Het
Pcdhga5 A G 18: 37,695,525 D342G probably damaging Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Plec A T 15: 76,176,935 I2934N probably damaging Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Prrt4 A G 6: 29,177,719 L17P probably damaging Het
Pycrl T C 15: 75,918,289 D171G probably damaging Het
Rapsn A G 2: 91,044,948 T359A probably benign Het
Sap25 C T 5: 137,641,924 R66W probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Ttll3 AAAGT AAAGTTAAGT 6: 113,399,158 probably null Het
Ttll3 AGTAAG AGTAAGGTAAG 6: 113,399,160 probably null Het
Txndc2 A G 17: 65,638,243 V313A probably benign Het
Uevld A T 7: 46,926,352 I462N probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Zfp936 A G 7: 43,190,296 T396A possibly damaging Het
Other mutations in Rapgefl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Rapgefl1 APN 11 98847135 missense probably damaging 1.00
IGL03088:Rapgefl1 APN 11 98849232 missense probably damaging 1.00
IGL03048:Rapgefl1 UTSW 11 98837164 missense possibly damaging 0.96
R1807:Rapgefl1 UTSW 11 98845989 critical splice donor site probably null
R1862:Rapgefl1 UTSW 11 98842209 missense probably benign
R4078:Rapgefl1 UTSW 11 98849977 missense probably benign 0.34
R4079:Rapgefl1 UTSW 11 98849977 missense probably benign 0.34
R4869:Rapgefl1 UTSW 11 98851109 missense probably damaging 1.00
R5994:Rapgefl1 UTSW 11 98850160 missense probably benign 0.06
R6275:Rapgefl1 UTSW 11 98851120 missense probably damaging 1.00
R6930:Rapgefl1 UTSW 11 98847121 missense probably damaging 1.00
R7138:Rapgefl1 UTSW 11 98847074 critical splice acceptor site probably null
R7432:Rapgefl1 UTSW 11 98851114 missense probably damaging 1.00
R7516:Rapgefl1 UTSW 11 98846134 missense probably benign 0.12
R7761:Rapgefl1 UTSW 11 98837659 missense probably benign 0.05
R7824:Rapgefl1 UTSW 11 98851154 missense probably damaging 1.00
R8018:Rapgefl1 UTSW 11 98840340 critical splice donor site probably null
Z1088:Rapgefl1 UTSW 11 98845895 missense probably damaging 0.99
Z1176:Rapgefl1 UTSW 11 98845981 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACGTTCAAGTGTGTATTTTC -3'
(R):5'- ACCTTGTGATAGGAAACGCC -3'

Sequencing Primer
(F):5'- CAAGTGTGTATTTTCTTAGACTGCTC -3'
(R):5'- CTTGTGATAGGAAACGCCTCCAG -3'
Posted On2019-11-26